ID: 1075022276

View in Genome Browser
Species Human (GRCh38)
Location 10:118960641-118960663
Sequence TACCCTGCCTGCCTCTTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075022270_1075022276 8 Left 1075022270 10:118960610-118960632 CCCCACCATGAAGCGGACTGGTT No data
Right 1075022276 10:118960641-118960663 TACCCTGCCTGCCTCTTCATGGG No data
1075022267_1075022276 29 Left 1075022267 10:118960589-118960611 CCTAGAGCATCTTTATTTTATCC No data
Right 1075022276 10:118960641-118960663 TACCCTGCCTGCCTCTTCATGGG No data
1075022271_1075022276 7 Left 1075022271 10:118960611-118960633 CCCACCATGAAGCGGACTGGTTT No data
Right 1075022276 10:118960641-118960663 TACCCTGCCTGCCTCTTCATGGG No data
1075022274_1075022276 3 Left 1075022274 10:118960615-118960637 CCATGAAGCGGACTGGTTTGGAA No data
Right 1075022276 10:118960641-118960663 TACCCTGCCTGCCTCTTCATGGG No data
1075022272_1075022276 6 Left 1075022272 10:118960612-118960634 CCACCATGAAGCGGACTGGTTTG No data
Right 1075022276 10:118960641-118960663 TACCCTGCCTGCCTCTTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075022276 Original CRISPR TACCCTGCCTGCCTCTTCAT GGG Intergenic
No off target data available for this crispr