ID: 1075022279

View in Genome Browser
Species Human (GRCh38)
Location 10:118960644-118960666
Sequence AGCCCCATGAAGAGGCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075022279_1075022289 10 Left 1075022279 10:118960644-118960666 CCTGCCTGCCTCTTCATGGGGCT No data
Right 1075022289 10:118960677-118960699 CTGAGCAAGATGGCAGGAGGTGG No data
1075022279_1075022287 7 Left 1075022279 10:118960644-118960666 CCTGCCTGCCTCTTCATGGGGCT No data
Right 1075022287 10:118960674-118960696 GTCCTGAGCAAGATGGCAGGAGG No data
1075022279_1075022285 0 Left 1075022279 10:118960644-118960666 CCTGCCTGCCTCTTCATGGGGCT No data
Right 1075022285 10:118960667-118960689 GGGTGTGGTCCTGAGCAAGATGG No data
1075022279_1075022286 4 Left 1075022279 10:118960644-118960666 CCTGCCTGCCTCTTCATGGGGCT No data
Right 1075022286 10:118960671-118960693 GTGGTCCTGAGCAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075022279 Original CRISPR AGCCCCATGAAGAGGCAGGC AGG (reversed) Intergenic
No off target data available for this crispr