ID: 1075022285

View in Genome Browser
Species Human (GRCh38)
Location 10:118960667-118960689
Sequence GGGTGTGGTCCTGAGCAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075022279_1075022285 0 Left 1075022279 10:118960644-118960666 CCTGCCTGCCTCTTCATGGGGCT No data
Right 1075022285 10:118960667-118960689 GGGTGTGGTCCTGAGCAAGATGG No data
1075022282_1075022285 -4 Left 1075022282 10:118960648-118960670 CCTGCCTCTTCATGGGGCTGGGT No data
Right 1075022285 10:118960667-118960689 GGGTGTGGTCCTGAGCAAGATGG No data
1075022274_1075022285 29 Left 1075022274 10:118960615-118960637 CCATGAAGCGGACTGGTTTGGAA No data
Right 1075022285 10:118960667-118960689 GGGTGTGGTCCTGAGCAAGATGG No data
1075022283_1075022285 -8 Left 1075022283 10:118960652-118960674 CCTCTTCATGGGGCTGGGTGTGG No data
Right 1075022285 10:118960667-118960689 GGGTGTGGTCCTGAGCAAGATGG No data
1075022278_1075022285 1 Left 1075022278 10:118960643-118960665 CCCTGCCTGCCTCTTCATGGGGC No data
Right 1075022285 10:118960667-118960689 GGGTGTGGTCCTGAGCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075022285 Original CRISPR GGGTGTGGTCCTGAGCAAGA TGG Intergenic
No off target data available for this crispr