ID: 1075022404

View in Genome Browser
Species Human (GRCh38)
Location 10:118961407-118961429
Sequence CCAGTGAGGTTCCTGAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075022395_1075022404 29 Left 1075022395 10:118961355-118961377 CCTCACCTGTCAGCAGAGGAGAG No data
Right 1075022404 10:118961407-118961429 CCAGTGAGGTTCCTGAAGCCTGG No data
1075022399_1075022404 24 Left 1075022399 10:118961360-118961382 CCTGTCAGCAGAGGAGAGGGGAT No data
Right 1075022404 10:118961407-118961429 CCAGTGAGGTTCCTGAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075022404 Original CRISPR CCAGTGAGGTTCCTGAAGCC TGG Intergenic
No off target data available for this crispr