ID: 1075022739

View in Genome Browser
Species Human (GRCh38)
Location 10:118963552-118963574
Sequence CCGGGGTGCCCAGTGTCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075022739_1075022746 -8 Left 1075022739 10:118963552-118963574 CCCGCAGACACTGGGCACCCCGG No data
Right 1075022746 10:118963567-118963589 CACCCCGGGGGAAGAAGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075022739 Original CRISPR CCGGGGTGCCCAGTGTCTGC GGG (reversed) Intergenic
No off target data available for this crispr