ID: 1075026700

View in Genome Browser
Species Human (GRCh38)
Location 10:118990169-118990191
Sequence TCCCAAAGTTGCGGGATTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075026693_1075026700 -8 Left 1075026693 10:118990154-118990176 CCACCCACCTCAGCCTCCCAAAG 0: 23522
1: 76482
2: 160024
3: 176046
4: 158971
Right 1075026700 10:118990169-118990191 TCCCAAAGTTGCGGGATTGCAGG No data
1075026692_1075026700 3 Left 1075026692 10:118990143-118990165 CCTCAGGTGATCCACCCACCTCA 0: 4906
1: 20582
2: 48775
3: 75197
4: 87746
Right 1075026700 10:118990169-118990191 TCCCAAAGTTGCGGGATTGCAGG No data
1075026689_1075026700 26 Left 1075026689 10:118990120-118990142 CCAGGCTGGTCTCAAACTCCTGA 0: 43524
1: 116818
2: 176857
3: 202641
4: 129199
Right 1075026700 10:118990169-118990191 TCCCAAAGTTGCGGGATTGCAGG No data
1075026691_1075026700 8 Left 1075026691 10:118990138-118990160 CCTGACCTCAGGTGATCCACCCA 0: 15131
1: 42916
2: 78223
3: 96454
4: 105535
Right 1075026700 10:118990169-118990191 TCCCAAAGTTGCGGGATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075026700 Original CRISPR TCCCAAAGTTGCGGGATTGC AGG Intergenic
No off target data available for this crispr