ID: 1075031699

View in Genome Browser
Species Human (GRCh38)
Location 10:119028929-119028951
Sequence CGGTAAGAGCGGAGGGACGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075031699_1075031707 9 Left 1075031699 10:119028929-119028951 CCTGCGTCCCTCCGCTCTTACCG No data
Right 1075031707 10:119028961-119028983 CCACAGCCTCCCCGAACCTCAGG No data
1075031699_1075031708 10 Left 1075031699 10:119028929-119028951 CCTGCGTCCCTCCGCTCTTACCG No data
Right 1075031708 10:119028962-119028984 CACAGCCTCCCCGAACCTCAGGG No data
1075031699_1075031712 19 Left 1075031699 10:119028929-119028951 CCTGCGTCCCTCCGCTCTTACCG No data
Right 1075031712 10:119028971-119028993 CCCGAACCTCAGGGTTTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075031699 Original CRISPR CGGTAAGAGCGGAGGGACGC AGG (reversed) Intergenic
No off target data available for this crispr