ID: 1075032137

View in Genome Browser
Species Human (GRCh38)
Location 10:119030427-119030449
Sequence GAACACGCACACCTGCAGCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 126}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075032137_1075032139 -7 Left 1075032137 10:119030427-119030449 CCGAGCTGCAGGTGTGCGTGTTC 0: 1
1: 0
2: 0
3: 7
4: 126
Right 1075032139 10:119030443-119030465 CGTGTTCTGCCGGAACAACAAGG 0: 1
1: 0
2: 0
3: 3
4: 75
1075032137_1075032143 29 Left 1075032137 10:119030427-119030449 CCGAGCTGCAGGTGTGCGTGTTC 0: 1
1: 0
2: 0
3: 7
4: 126
Right 1075032143 10:119030479-119030501 CTACACCACCCATATCCTCAAGG 0: 1
1: 0
2: 3
3: 12
4: 101
1075032137_1075032144 30 Left 1075032137 10:119030427-119030449 CCGAGCTGCAGGTGTGCGTGTTC 0: 1
1: 0
2: 0
3: 7
4: 126
Right 1075032144 10:119030480-119030502 TACACCACCCATATCCTCAAGGG 0: 1
1: 0
2: 1
3: 6
4: 97
1075032137_1075032140 -4 Left 1075032137 10:119030427-119030449 CCGAGCTGCAGGTGTGCGTGTTC 0: 1
1: 0
2: 0
3: 7
4: 126
Right 1075032140 10:119030446-119030468 GTTCTGCCGGAACAACAAGGAGG 0: 1
1: 0
2: 0
3: 5
4: 74
1075032137_1075032142 2 Left 1075032137 10:119030427-119030449 CCGAGCTGCAGGTGTGCGTGTTC 0: 1
1: 0
2: 0
3: 7
4: 126
Right 1075032142 10:119030452-119030474 CCGGAACAACAAGGAGGCGATGG 0: 1
1: 0
2: 1
3: 9
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075032137 Original CRISPR GAACACGCACACCTGCAGCT CGG (reversed) Exonic
900561847 1:3311082-3311104 CAACAGGCACCCCTGAAGCTGGG - Intronic
905921907 1:41725237-41725259 GGACATGCAGACATGCAGCTGGG + Intronic
913181861 1:116330110-116330132 GATGAGGCACACCTGCATCTGGG + Intergenic
914334930 1:146705542-146705564 GAACCCTCACATCTGTAGCTAGG + Intergenic
915465941 1:156097918-156097940 GCACACGCACCCCTGCCCCTAGG - Intronic
916606064 1:166343342-166343364 GCCCACGCCCACCTGCAACTCGG + Intergenic
920340390 1:205271958-205271980 GGACACGAACACCAGCAGCACGG - Exonic
920874161 1:209818696-209818718 ACACACGCACACCTTCATCTGGG + Intergenic
1065965629 10:30768082-30768104 GCACACGCAGACCTGGGGCTTGG + Intergenic
1069812294 10:71171228-71171250 AAATACGAACACCTTCAGCTTGG + Intergenic
1070804436 10:79262757-79262779 GCACAGGGACCCCTGCAGCTGGG + Intronic
1075032137 10:119030427-119030449 GAACACGCACACCTGCAGCTCGG - Exonic
1075976716 10:126702430-126702452 GAACAAGGACACCGGGAGCTGGG + Intergenic
1081718977 11:45272780-45272802 AAACAGACACACCTGCAGGTAGG - Intronic
1089505363 11:118958614-118958636 GACCAGGAGCACCTGCAGCTTGG - Intergenic
1090648545 11:128786616-128786638 ACACACGCACATCTGCAGCCTGG - Intronic
1090928858 11:131277647-131277669 GCCCAAGTACACCTGCAGCTGGG - Intergenic
1091367146 11:135031772-135031794 CAACACTCACTCCTGCTGCTTGG - Intergenic
1091548274 12:1518894-1518916 GAAGACACACCCCTGCAGCACGG + Intergenic
1091806912 12:3363481-3363503 GATCCCTCACACCAGCAGCTTGG - Intergenic
1092161726 12:6318740-6318762 GAACAGGTACACGTCCAGCTGGG - Exonic
1092351946 12:7762791-7762813 GAACACGGACATCAGAAGCTGGG - Intergenic
1093429952 12:19072962-19072984 GAACACCCACTCCTCCAGCATGG - Intergenic
1103909884 12:124346402-124346424 GAACACGCACAGCTGAGGCCCGG + Intronic
1113731038 13:112641726-112641748 GGAAACGGACACCTGCAGCGAGG - Intergenic
1113947926 13:114055113-114055135 GAACATGCACACCTGCCTGTGGG - Intronic
1114537956 14:23434870-23434892 GAACACTCATGCCTGCTGCTTGG + Intronic
1116720541 14:48490160-48490182 GAGCACACACACCTGCAATTTGG - Intergenic
1119521153 14:75286476-75286498 GAACACGTACTCCTGCAGCAGGG + Intergenic
1120191022 14:81439433-81439455 GAACATGCAAACTTTCAGCTGGG - Intergenic
1130954895 15:88620972-88620994 GTACACCCACATCTGCAGATTGG - Intergenic
1132702661 16:1228752-1228774 GACCACGCCCGCCTGCAGCCAGG + Exonic
1132705665 16:1242116-1242138 GACCACGCCCGCCTGCAGCCAGG - Exonic
1132709010 16:1258372-1258394 GACCACGCCCGCCTGCAGTTAGG - Exonic
1133136343 16:3714800-3714822 AGACACGCACACCTGAAGCCAGG + Intronic
1135351350 16:21731839-21731861 GAACACACACAACTTCACCTAGG + Intronic
1135449833 16:22547965-22547987 GAACACACACAACTTCACCTAGG + Intergenic
1139998693 16:71005694-71005716 GAACCCTCACATCTGTAGCTAGG - Intronic
1141949273 16:87330282-87330304 GAAAAGCCACACCTGCATCTGGG - Exonic
1143104592 17:4522644-4522666 GACCACGCACACATTCAGCCTGG + Intronic
1147326401 17:39671761-39671783 GAACATGCACACAGGCAGCCTGG + Exonic
1149075103 17:52587405-52587427 GAAAACACACACATGCAGCTGGG + Intergenic
1152230506 17:79111988-79112010 GGGCACGCACACCTGCACATAGG - Intronic
1152697794 17:81805223-81805245 GGACCCGCAGACCTGGAGCTGGG - Intronic
1152900412 17:82937895-82937917 GCACACACACACCTCCGGCTTGG + Intronic
1153706024 18:7746897-7746919 GTACACGTACACTTGAAGCTGGG - Intronic
1153923142 18:9808845-9808867 CAACAAGCACAGCTCCAGCTGGG - Intronic
1154950970 18:21209459-21209481 CAACAGGCACACCTGTAGTTGGG - Intergenic
1157618910 18:49004019-49004041 GACCACCCATACCTGCACCTGGG + Intergenic
1158265714 18:55658852-55658874 GAACACACACACATACACCTTGG - Intronic
1158457661 18:57622096-57622118 GGACCCGCACGCCTCCAGCTGGG - Exonic
1162104921 19:8364454-8364476 GCGCACGGACTCCTGCAGCTCGG + Exonic
1162885674 19:13695204-13695226 GAACAAGCACCCCAGCTGCTGGG + Intergenic
1165530996 19:36401268-36401290 GAATACGTACACCTGGAACTTGG - Intronic
1166367130 19:42283669-42283691 GAACACGCTCACGCGCGGCTCGG - Intronic
926415838 2:12649178-12649200 GAACACCTGCTCCTGCAGCTGGG - Intergenic
927096254 2:19749757-19749779 GCACAGGTACACCTGCAGGTTGG + Intergenic
928256313 2:29726001-29726023 GACCAAGCACACCTGCAGCAGGG - Intronic
932573742 2:72951525-72951547 GCACACACACACCTGCAGCCAGG + Intronic
932717279 2:74110768-74110790 GTACACACACCCCTGCTGCTCGG + Intergenic
934870209 2:97857742-97857764 GAACACCGACACCTTCACCTTGG + Intronic
935667494 2:105525384-105525406 AAGCACGCACACATGCAGCTTGG - Intergenic
941688953 2:168478375-168478397 GAACATGAACACCTCCAGATTGG - Intronic
1173424167 20:42928392-42928414 GAGCCCTGACACCTGCAGCTGGG + Intronic
1175184995 20:57174037-57174059 GACCACATCCACCTGCAGCTGGG - Intronic
1175408935 20:58753328-58753350 AAACACGCACAACTTCAGCCTGG - Intergenic
1175992476 20:62796621-62796643 GAAGAGGCACACCTCCACCTCGG - Exonic
1181898975 22:26136839-26136861 GCACACCCACATCTGCAGTTGGG - Intergenic
1182190825 22:28459010-28459032 ACACACCCACCCCTGCAGCTAGG - Intronic
1184549399 22:45196483-45196505 CAACACGCACACCTCCAACCTGG - Exonic
1185113742 22:48919490-48919512 GAAGCCGCTGACCTGCAGCTGGG - Intergenic
949939903 3:9146960-9146982 CTCCACGCACACCTGCAGTTTGG + Intronic
951535811 3:23739637-23739659 GAACCCGCAGCACTGCAGCTTGG + Intergenic
953289778 3:41649568-41649590 GAGCACGGACACCCCCAGCTGGG - Intronic
961165958 3:124764050-124764072 CAACACTCACACCTGCAGTCTGG - Intronic
962472183 3:135719992-135720014 GAAGACTCAGATCTGCAGCTAGG - Intergenic
977332194 4:95651371-95651393 GGACACGAATACCTGGAGCTGGG - Intergenic
981114352 4:140972578-140972600 GAAAAGGCTCCCCTGCAGCTGGG + Intronic
982499728 4:156138117-156138139 GAAAACCAACACCAGCAGCTGGG + Intergenic
984814704 4:183825540-183825562 GGACACACACACCTACAGCGAGG - Intergenic
985696623 5:1344668-1344690 GCGGACGCTCACCTGCAGCTTGG + Exonic
987389291 5:17360901-17360923 GGACACGGACACATGCAGGTGGG + Intergenic
988629849 5:32917157-32917179 GGACACGTAGACCTGCATCTAGG - Intergenic
991295684 5:65077807-65077829 ACACACGCACACATGCATCTTGG + Intergenic
993872373 5:93267857-93267879 CACCACGCCCACCAGCAGCTGGG - Intergenic
995749642 5:115440906-115440928 GAACAGGCAGACCTGCAGTGTGG - Intergenic
997235429 5:132269572-132269594 GAACAGGCAGACCAGCAGTTGGG - Intronic
1002338193 5:178494895-178494917 GCACACGCACATCTGCCTCTGGG + Intronic
1003329303 6:5116544-5116566 AGACCCTCACACCTGCAGCTTGG - Intronic
1005471428 6:26165627-26165649 GAACACCCACAGCTGAGGCTTGG + Intronic
1015069093 6:129067749-129067771 GAACACTCACACCTGCCTCAGGG + Intronic
1017694468 6:157000740-157000762 GAGAACGCACCCCTGCAGCCTGG - Intronic
1019180246 6:170182338-170182360 GAGCATCCACACCTGCAGGTGGG + Intergenic
1019305896 7:335611-335633 GGCCACGCAAACCTGCAGCCAGG - Intergenic
1019577626 7:1745135-1745157 GAGCTCGCACACCGACAGCTTGG - Exonic
1022357495 7:29629779-29629801 CAACACACACTCCTGCAACTGGG - Intergenic
1026776344 7:73233399-73233421 CAACATGCATACCTGCAGCCGGG + Intergenic
1026916247 7:74121749-74121771 GAACACAGACACCTGGAACTTGG - Exonic
1027017196 7:74786768-74786790 CAACATGCATACCTGCAGCCGGG + Intronic
1027070827 7:75159164-75159186 CAACATGCATACCTGCAGCCGGG - Intergenic
1029220218 7:98982853-98982875 GAAAAGGCACGCCTGCAGCAGGG + Intronic
1034327181 7:150247351-150247373 GAACATGCACATCTTCACCTGGG + Exonic
1034766029 7:153722106-153722128 GAACATGCACATCTTCACCTGGG - Intergenic
1035050586 7:155996625-155996647 AAAGGCGCCCACCTGCAGCTGGG - Intergenic
1041007455 8:53509046-53509068 CAGCACCAACACCTGCAGCTTGG - Intergenic
1048602344 8:135931395-135931417 CCCCACACACACCTGCAGCTGGG + Intergenic
1048804600 8:138228391-138228413 AAACACCCGCTCCTGCAGCTGGG - Intronic
1049181833 8:141226851-141226873 GACCACTCACTCCTGCAGCCTGG - Intronic
1049256664 8:141617764-141617786 GGACACACACACCTGCAGCCTGG - Intergenic
1049256684 8:141617846-141617868 GGACACACACACCTACAGCCTGG - Intergenic
1049360586 8:142210864-142210886 GAGCCCTCACACCTGCAGCCAGG + Intergenic
1049475115 8:142793744-142793766 CAACACGCACACCTCCTGCAGGG - Intergenic
1050537217 9:6641294-6641316 GAACACTCAAGCCTGCTGCTAGG - Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053619210 9:39798816-39798838 AAGCATGCACACATGCAGCTGGG + Intergenic
1053877368 9:42558165-42558187 AAGCATGCACACATGCAGCTGGG + Intergenic
1053895295 9:42736523-42736545 AAGCATGCACACATGCAGCTGGG - Intergenic
1053914903 9:42938573-42938595 GAACTTGCACCCCTGCAGCAGGG - Intergenic
1054234327 9:62543557-62543579 AAGCATGCACACATGCAGCTGGG - Intergenic
1054264947 9:62908613-62908635 AAGCATGCACACATGCAGCTGGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057200484 9:93137203-93137225 GAACAGGCACACCGGAGGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058637637 9:107051772-107051794 CAACACACATACCTGCTGCTTGG - Intergenic
1059430934 9:114249956-114249978 AAACACGCACACGCGCAGCGAGG - Intronic
1060195384 9:121620260-121620282 AAACAGCCACACCTCCAGCTGGG - Intronic
1061177110 9:129004321-129004343 AAACACACACAACTGGAGCTGGG + Intronic
1062146818 9:134994182-134994204 TTACACCCACACCTGCAGCTGGG - Intergenic
1062534359 9:137015024-137015046 GAACTGGGACACCTGGAGCTCGG + Exonic
1186693769 X:12007307-12007329 GAACAGGGCCACCTTCAGCTGGG - Intergenic
1191108473 X:56787475-56787497 GATGACCCACACCTGCAGCCAGG - Intergenic
1195851250 X:109284133-109284155 GAACATGCCAACCTTCAGCTAGG + Intergenic