ID: 1075036957

View in Genome Browser
Species Human (GRCh38)
Location 10:119077516-119077538
Sequence TTGTATATAAATTAGGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 301}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075036957_1075036962 18 Left 1075036957 10:119077516-119077538 CCTTTGTCCTAATTTATATACAA 0: 1
1: 0
2: 3
3: 22
4: 301
Right 1075036962 10:119077557-119077579 TTTTTTTTTTTTTTTGGAGAAGG 0: 2676
1: 87395
2: 67301
3: 106475
4: 184656
1075036957_1075036960 12 Left 1075036957 10:119077516-119077538 CCTTTGTCCTAATTTATATACAA 0: 1
1: 0
2: 3
3: 22
4: 301
Right 1075036960 10:119077551-119077573 TCCGAATTTTTTTTTTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075036957 Original CRISPR TTGTATATAAATTAGGACAA AGG (reversed) Intronic
903195567 1:21684891-21684913 TGGTATAAAACATAGGACAATGG - Intronic
905468874 1:38176604-38176626 GTGTGTATGAATTTGGACAAGGG - Intergenic
907365369 1:53954462-53954484 TTGTAGAAAAGTTAGAACAATGG + Intronic
908896187 1:68902827-68902849 TTTTATATAAAATAGGAAGATGG + Intergenic
909870001 1:80727409-80727431 TTGTGTAACAATTAGGTCAATGG - Intergenic
910322147 1:85958361-85958383 TTCTATAAAAAATAGTACAAGGG - Intronic
910551921 1:88485261-88485283 TAATATATAAATTAGAACACTGG + Intergenic
910769389 1:90815717-90815739 ATGTATAGAAATTAAGACTATGG + Intergenic
910886849 1:91972927-91972949 TTGTATATCAAATGTGACAATGG + Intronic
910912538 1:92253056-92253078 TTCTATATGAATTAGAAGAAAGG - Intronic
911260135 1:95676297-95676319 TTATATATAAATTATATCAAGGG + Intergenic
911325074 1:96461799-96461821 TTGTATATCACATTGGACAATGG - Intergenic
912055639 1:105594956-105594978 TTGTAAGTGAATTAGGATAATGG - Intergenic
912164754 1:107029945-107029967 TTGTTGAGAAATTAGGAGAAAGG - Intergenic
912911359 1:113761897-113761919 TTCTTTGTAAAATAGGACAATGG - Exonic
916404009 1:164479169-164479191 TTGTATATAAATAAGGTAAATGG + Intergenic
917941998 1:179931893-179931915 TAGGATAAAAATTAGAACAAGGG + Intergenic
918632634 1:186736407-186736429 ATGTAAATAAATGAGGACATAGG + Intergenic
918643682 1:186876530-186876552 TTGCCTATAAATTAGGAGTAGGG + Intronic
918651627 1:186971428-186971450 AAGTATATAAATTTGGAGAAAGG - Intronic
919084363 1:192903584-192903606 TTGTAAATCAATAAGGACAGAGG - Intergenic
919329674 1:196155027-196155049 TTGAATATAAATGAGGAGACTGG + Intergenic
919538419 1:198817370-198817392 TTGTACAAAAATTAGGACCTAGG - Intergenic
920231443 1:204473150-204473172 TTCAAAATAAGTTAGGACAAAGG + Intronic
921259522 1:213373300-213373322 CTCTATGTTAATTAGGACAAGGG + Intergenic
921445675 1:215244249-215244271 TTATATATAAACTATGACTAGGG + Intergenic
921726312 1:218527609-218527631 CTGTCAATAAATTAGGAGAAAGG + Intergenic
921757199 1:218872449-218872471 TTGTTTATTGATTAGGACATAGG - Intergenic
923335108 1:232961667-232961689 TTTTATATAAATTTGGAATAGGG - Intronic
923370362 1:233305283-233305305 TTGTATAAAAAAAAGCACAAAGG + Intergenic
924604754 1:245523477-245523499 TTGTTTATAAATTTAGACTATGG - Intronic
1064851367 10:19712543-19712565 TTGTCTAAAAAATAGGAAAAAGG + Intronic
1065100613 10:22327618-22327640 TTGTATACAAATTAGTTCCAGGG + Exonic
1065297187 10:24288273-24288295 TAGTCTATAAAATAGGAAAATGG - Intronic
1065602468 10:27383660-27383682 TGGAAAATAAATTAGGAAAAAGG - Intergenic
1066164136 10:32767309-32767331 GTGTATAAAAATTAGGTAAAAGG - Intronic
1066693106 10:38052020-38052042 TTGTATATAATTGTGAACAACGG + Intronic
1067304851 10:45053278-45053300 TTGTATATACATGAGGTAAAAGG + Intergenic
1067700945 10:48571519-48571541 ATGCATAGAAATTAGAACAAGGG - Intronic
1068701300 10:60022985-60023007 TTGTATATTAATTGGGGCAGTGG + Intergenic
1071019877 10:81040598-81040620 TTTTATATAATTTCGTACAAAGG - Intergenic
1075036957 10:119077516-119077538 TTGTATATAAATTAGGACAAAGG - Intronic
1077705344 11:4479969-4479991 GGGTATATAGATTAGGATAAAGG + Intergenic
1079441756 11:20522173-20522195 TTGTATAAAAATAATGACAGTGG + Intergenic
1079951133 11:26806482-26806504 TTTAATATAAATTATGACTATGG - Intergenic
1080457918 11:32432029-32432051 CTGAATATTAATTAAGACAATGG - Intronic
1081523676 11:43907968-43907990 TTGTATATACCTTGGGACCAAGG + Intronic
1082721099 11:56677789-56677811 TTGAATAGAAATTATGACAGTGG - Intergenic
1082762712 11:57143022-57143044 TTGTATGTAACTTTGGGCAAGGG - Intergenic
1084356911 11:68645142-68645164 TTGAATACAAAGTAGGATAAAGG + Intergenic
1087038440 11:93775899-93775921 TTGTGTATAAATCAGGAAATGGG + Intronic
1088906557 11:114159534-114159556 TTGAAAATAAAATAGCACAAAGG + Intronic
1090683817 11:129092597-129092619 TTGTATATAAATAAGTAAGATGG - Intronic
1092080836 12:5714801-5714823 TTGTATATAGTTTAGGACGGTGG - Intronic
1092583230 12:9871258-9871280 GTGTATATAAATAAGTAAAATGG + Intergenic
1093190530 12:16069670-16069692 TTTTATATTAATTAAGGCAAAGG - Intergenic
1093222467 12:16439210-16439232 TTGGATATAAAGTATGACATGGG + Intronic
1094336590 12:29363429-29363451 TTTTATATAAATTAGCACAAAGG + Intronic
1096222995 12:49843775-49843797 TTTTATATAGATGAGGACACTGG + Intergenic
1097326267 12:58280399-58280421 TTTTCTCTAAATTAGGGCAAAGG - Intergenic
1098818564 12:75200922-75200944 TTTTATATAAAATATGAAAAGGG + Intronic
1099419167 12:82432217-82432239 TAGTATATAACTTAGAACACTGG - Intronic
1099597548 12:84686493-84686515 TTGTTTATAAATTTGGCTAAAGG + Intergenic
1099600686 12:84733365-84733387 TTGTATAGAAATAAAGATAATGG - Intergenic
1099696465 12:86027989-86028011 ATGTATACAACTTAGGTCAATGG - Intronic
1101219456 12:102622482-102622504 TTGTATATAAATTCTGACAAAGG - Intergenic
1103102150 12:118187436-118187458 TAGTGTATAAATGAGGACACTGG - Intronic
1103774687 12:123358427-123358449 TGGTTTATAAATTGTGACAAAGG - Intronic
1103959746 12:124601787-124601809 TTTTGCATAAATTAGGACATTGG - Intergenic
1105409079 13:20155691-20155713 TGGCATACAAAATAGGACAAGGG - Intronic
1105634621 13:22205044-22205066 TTTTATGTAAATTAGGACTCAGG + Intergenic
1105708825 13:22985691-22985713 TTGTATATAAATTATGTGAAGGG + Intergenic
1106628937 13:31450426-31450448 TTATATTTAATTTAGGAAAAAGG + Intergenic
1108027632 13:46195183-46195205 TTTTCTATAAACTAGGCCAAAGG + Intronic
1108617852 13:52152150-52152172 TTGTATAAATATTAAGTCAAAGG + Intronic
1108939392 13:55933429-55933451 TTATATATAAGTTAGGAATAAGG + Intergenic
1109172116 13:59109444-59109466 TGGTATAGAAATTTGGAAAAAGG - Intergenic
1111514183 13:89306246-89306268 TTATATTTAAATAAGTACAAGGG + Intergenic
1112092396 13:96095135-96095157 TTGAATATAAATTATGAAAATGG - Intronic
1112940272 13:104853577-104853599 ATGTATATAGAATAGGAGAAAGG + Intergenic
1113094390 13:106648406-106648428 TTGAATATGAATGAGGACTAGGG + Intergenic
1114158950 14:20140985-20141007 AGGTACATAAATGAGGACAAAGG + Intergenic
1115423778 14:33229573-33229595 TTTCATTTAAATTAGCACAAAGG + Intronic
1115934906 14:38541611-38541633 TTAAATATAAATTATTACAAAGG - Intergenic
1116043809 14:39718270-39718292 TTACATATCAATTTGGACAAAGG - Intergenic
1116567959 14:46475226-46475248 TTGGATAGAAATTAGGAGAATGG + Intergenic
1116631174 14:47335955-47335977 TTGTATTGAAATTTGAACAAGGG - Intronic
1117220057 14:53594651-53594673 TTATATATCAATTAATACAAAGG - Intergenic
1117244753 14:53873428-53873450 TAGTTTCTGAATTAGGACAAAGG + Intergenic
1118254377 14:64192669-64192691 TGGTATGTAAAATGGGACAATGG - Intronic
1120102510 14:80461634-80461656 TTGTAAATAAATTATAACAATGG - Intergenic
1121153281 14:91657920-91657942 GGGAATATAAATTAGTACAATGG + Intronic
1121787338 14:96672149-96672171 TTGGATATAAAGAAGTACAATGG - Intergenic
1202895529 14_GL000194v1_random:5705-5727 TGATATATAAATTAAGACGAAGG + Intergenic
1202894166 14_KI270722v1_random:188175-188197 TTGCATATAATTTAGGTTAATGG - Intergenic
1123897985 15:24847777-24847799 TTGTAAATCAATTAGCATAATGG - Intronic
1124485990 15:30117122-30117144 TCGTATCTATATTAGGAGAAGGG - Intergenic
1124517585 15:30380147-30380169 TCGTATCTATATTAGGAGAAGGG + Intronic
1124541065 15:30586108-30586130 TCGTATCTATATTAGGAGAAGGG - Intergenic
1124757593 15:32421476-32421498 TCGTATCTATATTAGGAGAAGGG + Intergenic
1124821709 15:33052796-33052818 GTGTATATAAAATAGGGGAAGGG - Intronic
1126241725 15:46452710-46452732 TTTTATACACATTAGGCCAATGG - Intergenic
1126439036 15:48667395-48667417 TTATATATAATTTACTACAAAGG + Intergenic
1127816799 15:62617839-62617861 TTGTATTTAAATTATGAAACCGG + Intronic
1128006889 15:64251060-64251082 TTGCAAATTAATGAGGACAATGG + Intronic
1128401229 15:67283287-67283309 CTGTATATACATTATTACAAAGG - Intronic
1128837347 15:70820880-70820902 TAGTATATAAATTAATATAAAGG + Intergenic
1129064972 15:72894770-72894792 TTGTATGTAAATTATACCAATGG - Intergenic
1135425477 16:22331810-22331832 TTGAATATAAATAAAAACAAAGG - Intronic
1135744425 16:25004011-25004033 TTGTTTGTAAATTGGGAAAAAGG - Intronic
1137355077 16:47754361-47754383 ATGTGTATCAATTAGGACATTGG + Intergenic
1138238783 16:55409319-55409341 TTATATATAATTTATTACAAAGG - Intronic
1138824916 16:60307560-60307582 TTTTGTATAAATTAGGAGACTGG - Intergenic
1138925546 16:61585906-61585928 TTTTAAATAAATTAGGTAAAGGG + Intergenic
1139018315 16:62717075-62717097 TTCTATACAAATAAGCACAAGGG - Intergenic
1139072259 16:63397140-63397162 TTATTTATTTATTAGGACAAGGG - Intergenic
1140279571 16:73542378-73542400 TTGTATAAAAATAAGGACGTTGG - Intergenic
1144383298 17:14724596-14724618 ATCTATTTAAATTAGTACAAAGG + Intergenic
1144607744 17:16682720-16682742 TGATACATAAATTAAGACAAAGG + Intergenic
1144904313 17:18627677-18627699 TGATACATAAATTAAGACAAAGG - Intergenic
1145197094 17:20903415-20903437 TGATACATAAATTAAGACAAAGG - Intergenic
1146797293 17:35791559-35791581 TTTTACAGAAATTATGACAAGGG + Intronic
1147507242 17:41031153-41031175 TTGTATATAATGTGAGACAATGG - Intergenic
1147967495 17:44200719-44200741 TGGGATCTAAATTAGGACGAGGG - Intergenic
1148195402 17:45709406-45709428 TGTTATATAAATTAGAACAGAGG - Intergenic
1150165533 17:62938075-62938097 TTCTATAAAAGTCAGGACAATGG + Intergenic
1155520947 18:26668564-26668586 TTGTATATAAAATGGTACAATGG - Intergenic
1155653791 18:28173707-28173729 ACGTATTTAAATTAGAACAATGG + Intronic
1156422157 18:36966444-36966466 TTGTGTATACATTTGCACAAGGG + Intronic
1156807206 18:41199308-41199330 TTTTGTATAAATAAGGGCAAAGG - Intergenic
1157227231 18:45877811-45877833 TTTTATAAAAATTACGACAGTGG - Intronic
1157555044 18:48607979-48608001 TTGGAAATAAATCAGGACGAAGG - Intronic
1157671585 18:49533717-49533739 TTATAGATAAATTATAACAATGG + Intergenic
1158066525 18:53416712-53416734 TAGTAAATAAATAAGGAAAAGGG - Intronic
1158093847 18:53747536-53747558 TTATATATAAACTAGGAAAACGG + Intergenic
1159471976 18:68868671-68868693 TTGAATATCAATTAGCATAAGGG - Intronic
1163400485 19:17089137-17089159 GTGTAGAAAAATGAGGACAAAGG + Intronic
1164879308 19:31717658-31717680 TTTTATATAAAGCAGGAGAAGGG + Intergenic
1168010146 19:53523517-53523539 TTGATTAAAAATTGGGACAAAGG - Intronic
925696762 2:6588550-6588572 CTGTATATAAAATAAAACAATGG + Intergenic
927004606 2:18834919-18834941 TTTTTTAAAAATTAGAACAATGG + Intergenic
927140664 2:20128830-20128852 TTGAATATAAAATTGGACAGGGG + Intergenic
927430217 2:23021078-23021100 CTCTATCTAAAATAGGACAAGGG + Intergenic
930519488 2:52447134-52447156 TTCAATAGAAATTAGAACAATGG + Intergenic
932953306 2:76319035-76319057 TTATGTATAAACTAGGGCAACGG + Intergenic
933393492 2:81702654-81702676 TTGTATGTATATTAGAACAAAGG - Intergenic
935086887 2:99856226-99856248 TTGTATATTTATTACAACAAAGG - Intronic
935823659 2:106919445-106919467 TTGTAAATAAATCAGGAGAATGG - Intergenic
936001750 2:108838404-108838426 TTGTATAGCAATCAGGAAAATGG - Intronic
937041837 2:118828098-118828120 TTGTAGATAAATTCGCAGAAAGG - Intergenic
937194811 2:120143935-120143957 TTATGTATAAAATAGGATAATGG + Intronic
939237250 2:139511849-139511871 TGAAATATAAATTAGTACAAGGG - Intergenic
939358508 2:141136660-141136682 TGGTAAATTAATTAGGAAAAAGG + Intronic
940538980 2:154986115-154986137 TGATAGATAAATAAGGACAAGGG + Intergenic
940605592 2:155920449-155920471 TTTTATATATATTAGGAAATGGG - Intergenic
940663169 2:156572945-156572967 TTGTCTATAAACTAGGACACAGG - Intronic
940724316 2:157318424-157318446 TTGTATATAAAATTGTAAAAAGG - Intergenic
943088873 2:183350450-183350472 TTGTACATAATATATGACAATGG - Intergenic
943884205 2:193192712-193192734 TTGAATGCAAATTAGTACAAAGG - Intergenic
943890743 2:193283132-193283154 TTGTAAAAAAATTAAGATAATGG - Intergenic
945634341 2:212328781-212328803 TTCCATATAAAATAGCACAAGGG - Intronic
945881315 2:215327900-215327922 TTTTTTTTAAATTAAGACAACGG + Intronic
948018079 2:234706434-234706456 TTCAAAATAAATTGGGACAAGGG - Intergenic
948043543 2:234924871-234924893 TTGTATATAATGTAAGACAAAGG + Intergenic
1169396244 20:5232557-5232579 TTGTATATGGTATAGGACAAGGG - Intergenic
1169397552 20:5246651-5246673 TTGTATAAAAATAAGCACATAGG - Intergenic
1170174775 20:13456728-13456750 TCCTGTATAAATTAAGACAAAGG - Intronic
1173602848 20:44308379-44308401 TTGTCTATAAAATGGAACAATGG - Intronic
1176615223 21:9021711-9021733 TGATATATAAATTAAGACGAAGG + Intergenic
1177279101 21:18955947-18955969 CTGTATATAATTTAGAGCAAAGG + Intergenic
1178106902 21:29329341-29329363 TTGTATAGAAATTGGGATAGAGG + Intronic
1181411791 22:22728208-22728230 TGATACATAAATTAAGACAAAGG + Intergenic
1182733303 22:32512598-32512620 TTGTATATAATATATGTCAAAGG - Exonic
1184876582 22:47279666-47279688 TTGTGAATTATTTAGGACAAGGG + Intergenic
951013826 3:17706789-17706811 TTTTATACAAATTATGAGAATGG - Intronic
951145758 3:19225059-19225081 TGAGATAAAAATTAGGACAAAGG + Intronic
953460377 3:43077230-43077252 TTGTAAAAAAGTTTGGACAAAGG + Intergenic
953893754 3:46777645-46777667 TTGTATATGATTTAAGATAAAGG - Intronic
956713357 3:72057573-72057595 TTGTTCATAAATCAGGATAAAGG - Intergenic
956858409 3:73298578-73298600 TTGTATAAAAATCAGGACAGGGG - Intergenic
956944387 3:74202941-74202963 CTGTATATAAAGTAGAAAAATGG + Intergenic
957813047 3:85253727-85253749 TTTTATGTAAATTAGGAATAAGG + Intronic
958504923 3:94963891-94963913 TTGAATAACAATTTGGACAATGG + Intergenic
958623805 3:96599480-96599502 TTGGGTATAAATTAGGATATAGG - Intergenic
959378749 3:105616788-105616810 TTGAATCAAAATTAAGACAAGGG + Intergenic
959482961 3:106895735-106895757 TTGTACATAATCTAGGCCAAAGG + Intergenic
959841404 3:110980842-110980864 TTGTTTATAAATTATAACATAGG - Intergenic
961198162 3:125021240-125021262 TTGTATCTATATTAGGTCCATGG - Intronic
963725244 3:148912551-148912573 ATAAATATAAATTAAGACAACGG - Intergenic
964228204 3:154431647-154431669 TTAAATATAAATTTGGAAAAGGG + Intergenic
965714054 3:171583639-171583661 TTGTATAGAAATGAGCATAATGG + Intergenic
966706324 3:182919553-182919575 TTGTATACATATTAAGATAATGG + Exonic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
971707909 4:30071348-30071370 TTGAATATCAATTATGAAAAAGG - Intergenic
971766163 4:30834853-30834875 TTCAAGATAAATTAGGACAGTGG - Intronic
971792912 4:31191818-31191840 ATCTATATAAATTACAACAATGG + Intergenic
971801163 4:31293522-31293544 TAGTATATATATTAAGACATTGG + Intergenic
971879212 4:32347374-32347396 TTGTATATTAATTAGCTTAATGG + Intergenic
972761787 4:42113396-42113418 TGGAATCTAAATGAGGACAATGG + Exonic
974405767 4:61466760-61466782 TTGTATATCAATTAATAAAATGG + Intronic
974620177 4:64344451-64344473 TTTTATATAAATTATGGAAAAGG + Intronic
975893527 4:79058243-79058265 TTATTTAAAAATTAGAACAAAGG - Intergenic
977466482 4:97388188-97388210 TTACATATATATTAGGACCAAGG - Intronic
979335746 4:119459667-119459689 CTGTATATTAATTTGGACAGTGG - Intergenic
979396113 4:120191576-120191598 TTAGATATAACCTAGGACAAGGG - Intergenic
979541158 4:121884493-121884515 TTGTATATAAAAGATAACAAAGG + Intronic
979580912 4:122358970-122358992 TTGTATATATATTTGAACAGTGG - Intronic
979677317 4:123424199-123424221 TTGTTTTTAAGTTAGGAAAAAGG - Intergenic
980436088 4:132776005-132776027 TTGTCTATAAACTAGGAAGATGG - Intergenic
981413698 4:144463133-144463155 TTTTATATAAATTGGGAAAATGG + Intergenic
982356926 4:154481144-154481166 CTGGGTATTAATTAGGACAATGG + Intronic
982885262 4:160771812-160771834 TCTTATGTAAATTAGAACAATGG - Intergenic
984090344 4:175365876-175365898 TTTTATATATACTAGGAGAAAGG + Intergenic
984188570 4:176576898-176576920 TTTTATATAAACTAAGACATGGG + Intergenic
988838819 5:35063198-35063220 TTGTTTATATATTAGAAAAATGG + Exonic
989004684 5:36797211-36797233 TAGTATAGAAATTCGGAGAAAGG - Intergenic
989550494 5:42729822-42729844 TTATATATAAATTAGGTAAAAGG + Intergenic
990640448 5:57778112-57778134 ATAGATATAAATAAGGACAATGG + Intergenic
992358193 5:76007635-76007657 TTCTAAATAAATTAATACAAGGG - Intergenic
993691713 5:91009185-91009207 TTGTATAGATATGAGGTCAAAGG + Intronic
993812730 5:92502654-92502676 CTGTATATAAATTAGAATATAGG - Intergenic
995905982 5:117123677-117123699 TAGTTTATTAATTAGGAAAAAGG - Intergenic
996882110 5:128311057-128311079 TTAAATATAAATTGGGAAAATGG - Intronic
997327493 5:133034137-133034159 TTGTATCTAATTTTGAACAAAGG - Intergenic
997928845 5:138055563-138055585 TTGTTTTCAAATTAGGAAAAGGG + Intergenic
998710562 5:144820307-144820329 TTGTATTCAAATTAGGAAGATGG - Intergenic
998712147 5:144838853-144838875 ATGTATATTTATTAAGACAATGG + Intergenic
999910155 5:156188819-156188841 TTGTATATTAATTTGTAAAAGGG - Intronic
1000174886 5:158742216-158742238 TGGAATATAAATTGAGACAAAGG - Intronic
1000189416 5:158895085-158895107 TGGTAAATAAATTTGGACAATGG - Intronic
1000619189 5:163463227-163463249 TTGTCTATAAATTATCACACAGG + Intronic
1002806162 6:576229-576251 TTGTATCTCAAATAGGAAAATGG + Intronic
1003001124 6:2334737-2334759 TAACATATAAATTAGGAAAAGGG + Intergenic
1004236127 6:13875664-13875686 TTGTAAATCAATAAGGACATGGG + Intergenic
1004739722 6:18447111-18447133 TTTTATATAAATAAGGGTAAGGG + Intronic
1006262419 6:32886373-32886395 TTCTATATATATTACAACAAAGG - Intergenic
1006966931 6:37996859-37996881 ATGTGAATAAATTAGGTCAATGG - Intronic
1007443571 6:41886131-41886153 TTGTATCTAAAAGAGGTCAAAGG - Intronic
1007867466 6:44988452-44988474 TTATAAGTAAATTAGGCCAAAGG + Intronic
1007987937 6:46225956-46225978 TTGTGTATAAAGTAGGAGGAAGG + Intronic
1008089133 6:47275736-47275758 TTCTATTTAAATTAGGTCACAGG - Intronic
1008177886 6:48290543-48290565 TTGTATTTAAAATAGGTAAAGGG - Intergenic
1008327455 6:50200945-50200967 TTGATTATAAATTAGGGAAATGG + Intergenic
1008736203 6:54547333-54547355 TTTTATATAAAATATGAAAAAGG + Intergenic
1008842046 6:55914297-55914319 TTGTATGTAAGCTAGGAGAAAGG - Intergenic
1010627903 6:78161100-78161122 TTATATATAAATATGGACATAGG - Intergenic
1011976291 6:93303601-93303623 ATGGAAATAAATTAAGACAAAGG + Intronic
1012138802 6:95594413-95594435 TGGTAGATGAATTAGGAAAAGGG + Intronic
1013265334 6:108491128-108491150 TTTTTTAAAAATCAGGACAAAGG + Intronic
1013874930 6:114813462-114813484 TTGTTTATAAATATAGACAAAGG - Intergenic
1014394762 6:120912939-120912961 TTTGAAATAAAATAGGACAAAGG - Intergenic
1014790790 6:125669571-125669593 TTGTATATAAACTACCACAGAGG + Intergenic
1015268296 6:131312020-131312042 TTGGATAGAAATTATGAGAATGG - Intergenic
1015925246 6:138302991-138303013 TTTGAAATAAATTAGGAGAAAGG - Intronic
1016193272 6:141297567-141297589 TTGTATATACATGAGTACTATGG - Intergenic
1016620430 6:146103222-146103244 TTATATATAACTTAGGAGATTGG + Intronic
1018341439 6:162855647-162855669 TTGAATGTAACTTATGACAAGGG + Intronic
1020611920 7:10408421-10408443 TTTTAGTTAAATTAAGACAATGG + Intergenic
1020896681 7:13949416-13949438 TTGAGTATAAATAAAGACAATGG + Intronic
1021806372 7:24360692-24360714 TGTTATATAAATTAGAAAAATGG + Intergenic
1023749788 7:43361479-43361501 CTGTGTATAAATGAGGACAGTGG + Intronic
1026388003 7:69870729-69870751 TTGTATAGAAAGTAGGACAAAGG + Intronic
1027615371 7:80416681-80416703 TTGGATATAAATTTGGATATTGG + Intronic
1027769151 7:82384747-82384769 TTGTATATAAATGACAAAAATGG + Intronic
1027800794 7:82746661-82746683 TTTTAAATATATTATGACAAAGG - Intergenic
1028169164 7:87575022-87575044 TTGTATACAAAGTAGGAGAATGG - Intronic
1028432697 7:90765815-90765837 ATGTATATAGACTATGACAAAGG + Intronic
1028636943 7:92999817-92999839 TTGGATACAAATTAAGAAAAGGG + Intergenic
1029119155 7:98254746-98254768 TTGTATAAACAATAGGACAGAGG + Intronic
1029893320 7:103954864-103954886 TTTTTTAAAAATTAGCACAAAGG - Intronic
1030341275 7:108383470-108383492 TTTGATATAACTTATGACAAGGG + Intronic
1031429173 7:121645291-121645313 TTGATTATAAACAAGGACAAGGG - Intergenic
1033680433 7:143589037-143589059 TTTTATATAATTAAGGACATTGG + Intergenic
1033704461 7:143872775-143872797 TTTTATATAATTAAGGACATTGG - Intronic
1035004117 7:155642742-155642764 TTGTTCATAGATAAGGACAAGGG + Intronic
1037021860 8:13982826-13982848 TAGTATTTAAAGTAGAACAATGG + Intergenic
1037436057 8:18864722-18864744 TTGTAAATATATTAATACAATGG + Intronic
1040520720 8:48173807-48173829 TTGTATGTAAATCAGGACATTGG + Intergenic
1041384388 8:57283590-57283612 CGGTATATACAATAGGACAATGG - Intergenic
1041867279 8:62590145-62590167 TTGTGTTTAAAGTAGGAAAAGGG + Intronic
1043834986 8:85035661-85035683 TTAAATATGAATTAGAACAAAGG + Intergenic
1044019889 8:87093143-87093165 CTGTATAGAACTTAGGAAAATGG + Intronic
1044644728 8:94426663-94426685 TTTTTTTTAAATTAGGACAATGG + Intronic
1045453341 8:102350539-102350561 TTGTATATAATGTAAGATAAGGG - Intronic
1045928563 8:107598484-107598506 ATGGATATAAAGTAGGAAAAAGG - Intergenic
1046157837 8:110316834-110316856 GAGTATATAAATTAGGATTAAGG + Intergenic
1047081143 8:121462196-121462218 TTGTATACAAAGTAAGATAAGGG - Intergenic
1048199941 8:132364191-132364213 TAGAATACAAATTAGGACACAGG + Intronic
1048242883 8:132761698-132761720 TTGTAAATAAAGTAAGGCAAAGG + Intergenic
1048394868 8:134004318-134004340 TAGTATTTAAATTAGCACAACGG + Intergenic
1051011262 9:12417074-12417096 ATGTATATAAAGTAGGAGACTGG - Intergenic
1051062959 9:13066264-13066286 TTAGATCAAAATTAGGACAATGG + Intergenic
1052030412 9:23622074-23622096 TTGTCAATAAATTACCACAATGG + Intergenic
1052033830 9:23657882-23657904 TTAACTATAAATTAGGATAATGG - Intergenic
1052408115 9:28088334-28088356 TAGTATATACATTTGGACCATGG + Intronic
1056511048 9:87306073-87306095 TTGTATATAACTCAGCAAAATGG - Intergenic
1056912533 9:90715809-90715831 TAGTATATTAATTAATACAATGG + Intergenic
1057577886 9:96258172-96258194 TAGTATATAATGTATGACAAGGG - Intronic
1057798961 9:98177775-98177797 TTGTATATAATATAAGATAATGG - Intronic
1058116201 9:101086701-101086723 TTGTATATAGATTTTGACCAAGG - Intronic
1059682601 9:116600613-116600635 TTGTAGATAAAATAAGATAATGG + Intronic
1059997764 9:119929429-119929451 TTGTATATCATTCAGGACATAGG - Intergenic
1061361683 9:130147167-130147189 TTGTATATAGTGTAAGACAAAGG + Intergenic
1061599762 9:131660157-131660179 TTGTATATTAAGTAAGACAGAGG - Intronic
1185721377 X:2384692-2384714 TTGTATTTAAAATTGAACAATGG + Intronic
1185962658 X:4562620-4562642 TTTTATATAAATTAGCCCCATGG - Intergenic
1186793999 X:13026423-13026445 TTGTATTTAATCTAAGACAATGG - Intergenic
1188041203 X:25371502-25371524 ATGTAAATAACTTGGGACAAGGG + Intergenic
1190541230 X:51480825-51480847 ATTCATATAAATGAGGACAAGGG + Intergenic
1191989881 X:67023311-67023333 TTGTATATAATGTAAGACAAGGG + Intergenic
1192526618 X:71851202-71851224 TTGTATATAATATGAGACAAGGG - Intergenic
1193237556 X:79127318-79127340 TTGTATATAAATGACTATAAGGG - Intergenic
1193459185 X:81769984-81770006 TTATATATAAAAAAGGAGAAAGG + Intergenic
1194497188 X:94631171-94631193 TTTTATACAATTTAGGAAAATGG - Intergenic
1194963879 X:100266300-100266322 TTGTTTTTTAATTAGGCCAATGG + Intergenic
1196093940 X:111778048-111778070 ATGTCTATGAATTAGGATAATGG + Intronic
1196225676 X:113163637-113163659 TTTTATATAAATTAGAATAAAGG + Intergenic
1196976836 X:121167589-121167611 TTGTACAAAAATTAGGACATTGG - Intergenic
1197106104 X:122718212-122718234 TTGTATATACATTTGTACTATGG - Intergenic
1197995600 X:132369115-132369137 TTGTATATGAATTGTGAAAATGG + Intergenic
1198611687 X:138408532-138408554 GTGTATATGTATTAGGTCAATGG + Intergenic
1198694698 X:139323509-139323531 ATGTATATAAAGTAAGAAAAAGG + Intergenic
1199899008 X:152154600-152154622 TGTTAGATAAATGAGGACAATGG - Intergenic
1199968759 X:152843071-152843093 TGGTATATAATTTGAGACAAAGG + Intronic
1201449278 Y:14093347-14093369 TTGAATATAATTTAGAAGAAGGG + Intergenic
1201528149 Y:14959755-14959777 TTTTACATAAATTGGGCCAATGG - Intergenic
1201884953 Y:18871832-18871854 CTTTATATAAATTAGCCCAATGG - Intergenic