ID: 1075038009

View in Genome Browser
Species Human (GRCh38)
Location 10:119085462-119085484
Sequence AGCTTTTCCTGACAGCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075038004_1075038009 3 Left 1075038004 10:119085436-119085458 CCTCAGCTCAAAGGCTTCCTCTG No data
Right 1075038009 10:119085462-119085484 AGCTTTTCCTGACAGCCAGGGGG No data
1075038001_1075038009 29 Left 1075038001 10:119085410-119085432 CCACTATCTGCTGCCAGTACTTC No data
Right 1075038009 10:119085462-119085484 AGCTTTTCCTGACAGCCAGGGGG No data
1075038000_1075038009 30 Left 1075038000 10:119085409-119085431 CCCACTATCTGCTGCCAGTACTT No data
Right 1075038009 10:119085462-119085484 AGCTTTTCCTGACAGCCAGGGGG No data
1075038002_1075038009 16 Left 1075038002 10:119085423-119085445 CCAGTACTTCAAGCCTCAGCTCA No data
Right 1075038009 10:119085462-119085484 AGCTTTTCCTGACAGCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075038009 Original CRISPR AGCTTTTCCTGACAGCCAGG GGG Intergenic
No off target data available for this crispr