ID: 1075040718

View in Genome Browser
Species Human (GRCh38)
Location 10:119104623-119104645
Sequence CGCCCCCGGCTCGGGGGAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 96}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075040718_1075040728 -1 Left 1075040718 10:119104623-119104645 CCGGTTCCCCCGAGCCGGGGGCG 0: 1
1: 0
2: 0
3: 10
4: 96
Right 1075040728 10:119104645-119104667 GGGCGGCTGCCTCGGAGCCACGG No data
1075040718_1075040734 19 Left 1075040718 10:119104623-119104645 CCGGTTCCCCCGAGCCGGGGGCG 0: 1
1: 0
2: 0
3: 10
4: 96
Right 1075040734 10:119104665-119104687 CGGGTGACTGCCCGCCCGGGCGG No data
1075040718_1075040733 16 Left 1075040718 10:119104623-119104645 CCGGTTCCCCCGAGCCGGGGGCG 0: 1
1: 0
2: 0
3: 10
4: 96
Right 1075040733 10:119104662-119104684 CCACGGGTGACTGCCCGCCCGGG No data
1075040718_1075040727 -9 Left 1075040718 10:119104623-119104645 CCGGTTCCCCCGAGCCGGGGGCG 0: 1
1: 0
2: 0
3: 10
4: 96
Right 1075040727 10:119104637-119104659 CCGGGGGCGGGCGGCTGCCTCGG No data
1075040718_1075040731 15 Left 1075040718 10:119104623-119104645 CCGGTTCCCCCGAGCCGGGGGCG 0: 1
1: 0
2: 0
3: 10
4: 96
Right 1075040731 10:119104661-119104683 GCCACGGGTGACTGCCCGCCCGG No data
1075040718_1075040729 0 Left 1075040718 10:119104623-119104645 CCGGTTCCCCCGAGCCGGGGGCG 0: 1
1: 0
2: 0
3: 10
4: 96
Right 1075040729 10:119104646-119104668 GGCGGCTGCCTCGGAGCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075040718 Original CRISPR CGCCCCCGGCTCGGGGGAAC CGG (reversed) Intronic
901641223 1:10694160-10694182 CGGCCCCGGCTTGGGGGCCCTGG + Intronic
903349809 1:22710895-22710917 CGCCCCGGGCTCGGGGGGCCAGG - Intronic
904976671 1:34461880-34461902 CCCCTCAGGCTCTGGGGAACTGG + Intergenic
905847016 1:41241938-41241960 TGACCCCGGCCCGGGGGAGCAGG + Intronic
908555691 1:65254676-65254698 CGCCCCTGCCTCAGGGTAACAGG - Intronic
918540353 1:185625507-185625529 CGCCCCCAGCACAGGGAAACAGG - Intergenic
1067715109 10:48684914-48684936 CCCCTCAGGCTCGGGGGAAGAGG - Intronic
1074865430 10:117542121-117542143 CGGCCCCGCGTCGGGAGAACTGG - Intergenic
1075040718 10:119104623-119104645 CGCCCCCGGCTCGGGGGAACCGG - Intronic
1075413346 10:122245327-122245349 CTCCCCCGTCTCCTGGGAACGGG + Intronic
1076374207 10:129972749-129972771 CGCACCCGGCTCCGGGGCCCCGG + Intergenic
1076721269 10:132394430-132394452 CGCCCCTGGCTGGGGTGAAAAGG - Intergenic
1076998459 11:310747-310769 CGCCCCCACCACGGGGGAGCAGG - Intronic
1077000284 11:319012-319034 CGCCCCCACCACGGGGGAGCAGG + Intergenic
1080677180 11:34438917-34438939 CGCCACGGACTCGGGGCAACAGG + Exonic
1081860974 11:46333190-46333212 CGTCCCCGGCCCGGGCGGACTGG + Intronic
1081870518 11:46380881-46380903 CTCTCCCGGTTTGGGGGAACCGG + Exonic
1083892968 11:65605960-65605982 TTCCCCAGGCTTGGGGGAACTGG + Exonic
1084385188 11:68839352-68839374 CGCCCGGGGCTTGGGGGAAGGGG - Intronic
1086001556 11:81990904-81990926 AGCCCACGGCTGGGGGGAAGGGG + Intergenic
1094820214 12:34218892-34218914 CGCCCCAGGCGCGCGGGAATGGG - Intergenic
1097830756 12:64222192-64222214 CGCCCCGGTCCCGGTGGAACAGG - Exonic
1101131606 12:101696977-101696999 CTCCCCCTGCAAGGGGGAACAGG - Intronic
1101990089 12:109477319-109477341 CGCCCCCGGCTGGCGTGAGCTGG - Exonic
1108013851 13:46052532-46052554 CGCGCGCGGCTCCCGGGAACCGG + Intronic
1112595685 13:100804917-100804939 GGCCCCCAGCTCTTGGGAACTGG + Intergenic
1120765427 14:88323523-88323545 GGCACCCGGCTCGGGGCAGCGGG + Intronic
1122854027 14:104551607-104551629 TGACCCCGACTTGGGGGAACTGG - Intronic
1138186570 16:54982037-54982059 TGCCCCCGGCTCTAGGGAAGGGG - Intergenic
1143593943 17:7902965-7902987 GGCCCCCAGCTCGGGTGGACAGG - Exonic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1147620774 17:41865262-41865284 CGCCGCCGGCTCGGCAGGACTGG - Exonic
1147952682 17:44115786-44115808 CTCCCCCTGCTGGGGGGAGCTGG + Intronic
1148899447 17:50865667-50865689 CGCCCCGGGCTCCTGGGAGCCGG + Intronic
1151303521 17:73247018-73247040 CTGCCCCTGCTCGAGGGAACTGG - Intronic
1151854387 17:76710749-76710771 GGCCGCCGGCTCGGGGGCGCAGG + Exonic
1153773523 18:8433762-8433784 CTCCCCCCGCTCTGAGGAACTGG - Intergenic
1153872653 18:9334855-9334877 CGCCCCGGGCTCGGCCGACCCGG + Exonic
1155392111 18:25349635-25349657 CGCCGCCGGCCCGGGGAAAAGGG - Intronic
1157338267 18:46756828-46756850 CGCCTCCGGCTCGTGGCACCTGG - Exonic
1157753082 18:50195198-50195220 CGCCCCCGGCCCGGAGGCCCAGG - Intergenic
1160330454 18:77986937-77986959 CGGCCCCGGCACAGGGGCACTGG - Intergenic
1160592291 18:79951390-79951412 GGCGCACGGCTCGGGGGAAGGGG + Intronic
1160719537 19:591098-591120 CGCCCGCGGCTCGGGTGGAGCGG - Intronic
1160949323 19:1658023-1658045 TGCCCCCGCCTCGGGGTAACTGG - Intergenic
1161682565 19:5687387-5687409 CGGCCCCGGCTCTGCGGGACGGG + Intronic
1162100497 19:8335748-8335770 CGCCCCCGGCGGCGGGGACCGGG + Exonic
1162127266 19:8506309-8506331 CGCCCCCTGCTGGGCGGAGCCGG + Intergenic
1162413101 19:10518002-10518024 CGCCCCCGGCTCAGGGCGAGTGG + Intergenic
1163214373 19:15864815-15864837 CCCCCCAGGCTGGGGGAAACTGG - Intergenic
1163383725 19:16986166-16986188 GGGCCCCGGCAGGGGGGAACTGG - Intronic
1164673835 19:30088945-30088967 CCCCCCAGCCTCGAGGGAACCGG - Intergenic
1165939826 19:39409603-39409625 CGCCCCCGACGCCCGGGAACTGG - Intergenic
1166894666 19:46016077-46016099 CGCCCCCGACGCGGGAGGACCGG + Exonic
1167112589 19:47470982-47471004 CGCCCCTGGCAGGGGGGACCTGG - Intronic
1167463853 19:49640040-49640062 CGGCCCCGGGGCGGGGGACCTGG - Exonic
1167503926 19:49861667-49861689 CGCCCGCGGCTCGGGCACACTGG + Exonic
1168280793 19:55304564-55304586 AGCCCCCGGCTCCGGTGAAAAGG - Exonic
928990761 2:37231384-37231406 GGCCGCGGGCTCCGGGGAACGGG - Intronic
932180629 2:69643438-69643460 AGCTCCCGGCTCGGGGGTCCCGG - Intronic
936412947 2:112276212-112276234 CGACCCCGGCTCGGGGAGGCGGG - Intronic
941104895 2:161341129-161341151 GGCCGCCGGCTCGGGGGCGCAGG + Intronic
942046087 2:172100352-172100374 GGCCCCTCTCTCGGGGGAACCGG - Exonic
1172056803 20:32159829-32159851 CACCCCCTGCTCTGGGGAAGAGG + Intronic
1176041674 20:63068938-63068960 CACCCCCGGCTCTGGGGAGCTGG + Intergenic
1184508131 22:44916575-44916597 CGGTCCCGGCCCGGGGCAACGGG + Exonic
1184759504 22:46536800-46536822 CGTGCCCGGCTCTGCGGAACCGG - Exonic
1185054948 22:48574811-48574833 TGCCCCCTGCTCTGGGGAGCGGG + Intronic
950650220 3:14402552-14402574 CGCCCCCGGCCCGGCCGAGCTGG + Intergenic
956559054 3:70553312-70553334 CGCCCCCAGCTTGGGAGAATAGG + Intergenic
960955447 3:123027678-123027700 CCCGCCCGGCTCGGCGGAGCTGG + Intronic
965520191 3:169662937-169662959 CTCCCCCGCCTGGGGGGAAGGGG + Intronic
967780722 3:193436811-193436833 CGCGCCCGGCCCCGGGGATCAGG - Intronic
968674611 4:1870997-1871019 CGCCCACGGCTCGGGGGCGCCGG + Intergenic
984862534 4:184253270-184253292 CGCCCCCTGCTCAGGGGCACCGG + Intergenic
985769400 5:1799550-1799572 CGACCCCGGGGCGGGAGAACTGG - Intronic
995650112 5:114361180-114361202 CGCCCCCGCCAGGGGGGACCCGG + Intronic
995650411 5:114362363-114362385 CGCCCCCGCCGCCGGGGCACCGG - Exonic
999956603 5:156709857-156709879 CGCCCCCTACTCTGGGGAAATGG + Intronic
1001945324 5:175773327-175773349 AGCCCACGGCGCGGGGGAAGCGG - Intergenic
1005778423 6:29162247-29162269 CTCCCCTGGCTCGGGGAAAGAGG + Intergenic
1006472728 6:34237528-34237550 CGCCCGCGGCGCGGGGGAAGGGG - Intronic
1006576286 6:35048865-35048887 AGCCCCCGGCTCCTGGGAAGGGG + Intronic
1007849753 6:44791791-44791813 CGCCCCCTCCTTGGGGGAGCGGG - Intergenic
1014755930 6:125301941-125301963 CGACCCCGGCTGGGCGGAGCAGG + Exonic
1015843476 6:137495841-137495863 CTCTCCCGGCTTGGTGGAACGGG + Intergenic
1017891660 6:158644476-158644498 CGCCCCCCGCGCCGGGGAAACGG + Intronic
1018027895 6:159819869-159819891 GGCCCCCAGCTGGGGGGCACTGG - Intronic
1019113612 6:169738512-169738534 CTCCCCTGGCTTGGGGGAAGGGG + Intergenic
1019279526 7:192921-192943 CGCGCCCGGCTCCGCGGACCAGG + Intergenic
1022112339 7:27239452-27239474 CCCGCCCGGCTCGGGGGAGATGG - Intergenic
1029538789 7:101171202-101171224 CCCGCCCGGCTCGGGTGAGCTGG + Exonic
1034243058 7:149624422-149624444 CGCCTGGGGCTCCGGGGAACAGG - Intergenic
1035034214 7:155884743-155884765 GGCTCCCGGCTCCGGGGAACCGG - Intergenic
1038311365 8:26448791-26448813 CTGCCCCGGCTCGGGTGCACTGG - Intronic
1039455173 8:37701085-37701107 CGCCCCCGGCCCGATGGAGCGGG - Intergenic
1041107588 8:54458070-54458092 CTCCCCCGGGTCGGGGGAGGCGG + Exonic
1043929063 8:86069633-86069655 CGCCCGCCGCTCGCGGGACCTGG + Exonic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1049544180 8:143221807-143221829 CGCCCTCGGCTGGGGAGGACCGG - Intergenic
1057186022 9:93058136-93058158 GGCCCCCGGCTGGGGGAAACAGG - Intergenic
1059769854 9:117414887-117414909 CGGCCCCGGCTCGGGGCTCCGGG - Exonic
1060148025 9:121268512-121268534 CGCCCCCGGGATGGGGGAACTGG + Intronic
1061559759 9:131394580-131394602 CGGCCCGGCCTCGGGGGTACGGG - Intronic
1062536035 9:137021547-137021569 CACGCCGGGCTCGGGGGAGCTGG - Exonic
1185874484 X:3691417-3691439 CTCCCCCGGGGCGGGGGGACTGG - Intronic
1199792626 X:151169386-151169408 AGCCCCTTGCTCGGGGGAAGGGG + Intergenic