ID: 1075041825

View in Genome Browser
Species Human (GRCh38)
Location 10:119114079-119114101
Sequence AAACCCTCTGGGCCTCCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075041825_1075041829 14 Left 1075041825 10:119114079-119114101 CCAGAAGGAGGCCCAGAGGGTTT 0: 1
1: 0
2: 1
3: 14
4: 157
Right 1075041829 10:119114116-119114138 TGCGTGGCATTGTAGTATCCTGG 0: 1
1: 0
2: 0
3: 1
4: 45
1075041825_1075041828 -2 Left 1075041825 10:119114079-119114101 CCAGAAGGAGGCCCAGAGGGTTT 0: 1
1: 0
2: 1
3: 14
4: 157
Right 1075041828 10:119114100-119114122 TTCTCAGCTTGTGCAGTGCGTGG 0: 1
1: 0
2: 1
3: 13
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075041825 Original CRISPR AAACCCTCTGGGCCTCCTTC TGG (reversed) Intronic
900422321 1:2560961-2560983 CCTCCCTCTGGGCCTGCTTCTGG - Intronic
901027122 1:6284663-6284685 AAATCCTCTCCGCCTCCTCCAGG + Intronic
901240965 1:7692953-7692975 AACCCCTCTGTGCCTCCATCTGG + Intronic
902622887 1:17660629-17660651 AAAGCCCCTGGGTCTCCCTCAGG - Intronic
903427670 1:23266471-23266493 AATCCATCTGGGCCCCTTTCTGG - Intergenic
904264619 1:29311201-29311223 CAACCATCTGGTCCTCCTCCAGG + Intronic
910432531 1:87173196-87173218 CAATCTTCTGGGCCTCTTTCTGG + Intergenic
911533193 1:99070632-99070654 TGCCCCTCTGGACCTCCTTCTGG - Intergenic
912510702 1:110188438-110188460 ACACCCTCTGACCTTCCTTCCGG + Intronic
915255404 1:154624983-154625005 ATAAGCACTGGGCCTCCTTCTGG + Intronic
915310951 1:155005572-155005594 GAAGCCTCTGGGCCTGCTGCGGG + Intronic
917012314 1:170488419-170488441 AAACCCTCTGGGCTCCCTGTAGG - Intergenic
917255815 1:173115203-173115225 AAACCCTGTGGCCATCCTTTGGG + Intergenic
920119051 1:203642023-203642045 TAACCCTCTGGGCGTGCTTCTGG + Intronic
920691349 1:208148800-208148822 ACCCCCTCAGGGCCTCCTTCAGG - Intronic
920998054 1:211014087-211014109 AAAAGCTCTTGGCCACCTTCAGG + Intronic
1062828009 10:586521-586543 AAACTTTCTCGGCCTCCTCCGGG + Intronic
1064122160 10:12629219-12629241 CAAACCTCTGGGCTTTCTTCAGG + Intronic
1064254582 10:13732927-13732949 AATCCCTGTGGGGCTTCTTCTGG + Intronic
1065751418 10:28891025-28891047 AAACCATCTGGGTCTCCTTTGGG + Intergenic
1067202238 10:44183253-44183275 ACACCCTCTGGTTCTCCATCTGG + Intergenic
1070977245 10:80614990-80615012 AAACCCACTGGCCATCCTGCAGG + Intronic
1073077363 10:100832621-100832643 ATGCCCTCAGGGCCTCCTTTGGG - Intergenic
1074056698 10:109928685-109928707 AAACCCTCTGGGCCTCTTAAAGG - Intergenic
1074215275 10:111378156-111378178 AGATCCTATGGGCTTCCTTCTGG - Intergenic
1075041825 10:119114079-119114101 AAACCCTCTGGGCCTCCTTCTGG - Intronic
1075921952 10:126220923-126220945 GAAGCCTCTGGGCCTCCATGTGG - Intronic
1078699874 11:13669436-13669458 AAACCTTCTCAGCCACCTTCCGG - Intronic
1079088710 11:17465479-17465501 AAAACCTCTGGGCCTAGTCCTGG - Intronic
1081701019 11:45152902-45152924 AAACCCTCTGAGGCTCCCTGTGG - Intronic
1083332428 11:61905164-61905186 AGACCCTCAGTGCCTCCTTGAGG + Intronic
1083429926 11:62609013-62609035 GGACCCCCTGGGCCTCCTCCAGG + Exonic
1085618749 11:78021996-78022018 AATTCCTCTGGGAGTCCTTCGGG + Intronic
1088084596 11:105961439-105961461 AAAACCTCTCAGCCTCATTCAGG + Intronic
1089631300 11:119786296-119786318 AAACCCCCCTGGCCTCCATCTGG + Intergenic
1090749699 11:129734753-129734775 AAATCATCTGGGCCTCTTCCTGG + Intergenic
1096868605 12:54579386-54579408 GAGCCCTCGGGGCCTCCTCCTGG - Exonic
1104001416 12:124863220-124863242 ACACACTCTTGGGCTCCTTCGGG + Intronic
1104952502 12:132447948-132447970 AAACCCTGTGTGTCTCCTGCGGG - Intergenic
1106297527 13:28430219-28430241 AAAACCTTAGGGCCTCATTCAGG + Intronic
1106852407 13:33808760-33808782 AAACCATCTGAGCCTGCTTGGGG + Intergenic
1112319789 13:98395713-98395735 AAGTCCTCCCGGCCTCCTTCCGG + Intronic
1117364326 14:55010384-55010406 ATACCATCTGGAACTCCTTCAGG + Exonic
1121810975 14:96889939-96889961 AAACCATCTGAGGCACCTTCTGG + Intronic
1122141675 14:99666655-99666677 CTCCCCTCTGGGCCTCTTTCTGG - Intronic
1124597192 15:31101271-31101293 AAACCCTCTGAGCTTCCCTCAGG - Intronic
1125795675 15:42402490-42402512 AAGTCCTCTAGGCCTCCTTGGGG + Intronic
1126867875 15:52956158-52956180 AAACTCTCTGAGCCTTCATCTGG + Intergenic
1130175044 15:81559577-81559599 AAACCCTCTGGGCTCCATGCAGG + Intergenic
1130901051 15:88207006-88207028 GAACCTTCTGTTCCTCCTTCAGG + Intronic
1131462144 15:92624902-92624924 ACACCCTCTAGGCGTCCTCCAGG - Intronic
1131988170 15:98065911-98065933 ATACCCTCTGGACCTGCTTTGGG - Intergenic
1132239710 15:100248409-100248431 ATACCCTCTGGGCCTCTCTCTGG - Intronic
1138599123 16:58044830-58044852 AAGCCCTCTGAGCCTCAGTCTGG + Intronic
1139146419 16:64330677-64330699 ACAGTCTATGGGCCTCCTTCAGG - Intergenic
1141573960 16:84952340-84952362 AAACCCTCTATGGCTCCTTATGG - Intergenic
1143116264 17:4583483-4583505 CCAGCCTCTGGGCCTCTTTCAGG + Intergenic
1144455364 17:15414191-15414213 AGACCCTCATGGCCTCTTTCAGG - Intergenic
1147160282 17:38565741-38565763 AAACCCTCAAGGCCACCTTGGGG - Intronic
1148745375 17:49915145-49915167 AAACCCTCTCTGCCTGCCTCTGG + Intergenic
1152285663 17:79411330-79411352 AAACCCACTGAGACTCATTCTGG + Intronic
1155853113 18:30797018-30797040 AATCCTTCTTTGCCTCCTTCTGG - Intergenic
1156478172 18:37419690-37419712 AAACCCTCAGGGACGCCCTCCGG + Intronic
1160542239 18:79630360-79630382 AGAACCTCTCAGCCTCCTTCCGG - Intergenic
1162371190 19:10280528-10280550 AAACCAGCTGGGCTTCCTGCTGG - Intronic
1162372394 19:10287371-10287393 AAACACGCTGGGCCACCTCCAGG + Exonic
1164654305 19:29909781-29909803 ACACACCCTTGGCCTCCTTCCGG - Intergenic
1165829680 19:38724234-38724256 CGATCCTCTGGGCCTCCTTGTGG - Exonic
1166509698 19:43396608-43396630 TAAACCTCTGTTCCTCCTTCAGG - Intergenic
1166788943 19:45386099-45386121 CAACCCTCTGGTGCTCCTCCTGG - Exonic
1168287084 19:55340394-55340416 TCACCCTCCAGGCCTCCTTCTGG + Intronic
1168648563 19:58077695-58077717 ATACCCTGTGGACTTCCTTCAGG - Intronic
926903749 2:17786536-17786558 AAACTCACTGGGCCTCCAGCTGG - Exonic
927716345 2:25355824-25355846 ACACACTCAGGGCCTCCTGCCGG + Intergenic
928478190 2:31652952-31652974 AAATCCTTTGTTCCTCCTTCAGG - Intergenic
931557155 2:63518537-63518559 AAACCCTCTGGGCTCCCCACTGG - Intronic
931604504 2:64039312-64039334 ATACTCTCTGGACCTCCTACTGG - Intergenic
932411354 2:71549742-71549764 AACTCCTCTTGGCCTCCTCCTGG - Intronic
932579823 2:72985872-72985894 AACCTCTCTGGGACTCTTTCAGG - Intronic
932600734 2:73123415-73123437 ATACCTTCTGGGTCTCCTTCAGG + Intronic
933817374 2:86079225-86079247 AAACACTCAGGGTCCCCTTCTGG + Intronic
935871532 2:107455844-107455866 AAACCCTTTGGGCTCCCTACAGG - Intergenic
936090011 2:109495427-109495449 AGACACTCTGGGCCACCTACCGG + Intronic
938152316 2:128897995-128898017 AATCCCTCTGGGCATCATTTTGG - Intergenic
939147149 2:138429455-138429477 AAACTCTGTGGCCCTCCTTATGG - Intergenic
940099751 2:150021171-150021193 ACACCCTCTGTGCTTCCCTCGGG + Intergenic
942749190 2:179268707-179268729 ACACCCTCTGTGAGTCCTTCTGG - Intergenic
944310592 2:198229124-198229146 AAACCATCTGGGCCTCATAGTGG - Intronic
945150270 2:206783569-206783591 AATCCCTCTGGGGCTGTTTCTGG - Intronic
945983977 2:216339901-216339923 CATCTCTCTGGGCCTCCTGCTGG + Intronic
946155905 2:217806474-217806496 AATCCCTCTTTTCCTCCTTCAGG - Intronic
947596149 2:231412856-231412878 AGACCCTCAGGGCCACCTTAGGG + Intergenic
949052562 2:241904965-241904987 ATGCCCTCGGGGCCTCCTCCTGG + Intergenic
1168880750 20:1204303-1204325 ACACCCACTGGGCCTCCTTAAGG - Intronic
1168972312 20:1939062-1939084 ACACCCTCTGGCCAACCTTCTGG - Exonic
1172067353 20:32230941-32230963 CAGCCCTCTGGATCTCCTTCAGG - Exonic
1174281392 20:49442063-49442085 AACCCTTCTGAGCCTGCTTCAGG + Intronic
1175515524 20:59567477-59567499 AGAGCTGCTGGGCCTCCTTCTGG - Intergenic
1181323792 22:22029513-22029535 AAACACTCGGGGTCTCCCTCGGG + Intergenic
1181894176 22:26092598-26092620 AAACCCCTTGGTCATCCTTCAGG + Intergenic
1183212255 22:36458214-36458236 AGAGCCTCTGCCCCTCCTTCGGG + Intergenic
949616114 3:5755642-5755664 AAACCCTCTGGGACTCCCTTTGG + Intergenic
953039085 3:39238879-39238901 AACCTCTCTGGGCCTTATTCTGG + Intergenic
953684507 3:45066101-45066123 CAACCCTCTGGCCCTTCTTTGGG - Intergenic
953907524 3:46875803-46875825 AAACCCTTTGGGGCTCCCTGAGG - Intronic
955421350 3:58741353-58741375 AAAGCCTCTGGGATTTCTTCAGG + Intronic
956371711 3:68570654-68570676 AAACCCTCTGGGCTCCACTCTGG - Intergenic
958460033 3:94383175-94383197 AAACCCTCTGGGCTCCATGCAGG - Intergenic
960015712 3:112885458-112885480 AAACCCTCTGGGCTTCACACAGG + Intergenic
961049361 3:123733765-123733787 AATCCCTCTGGCCCTCCATGGGG + Exonic
962440891 3:135415228-135415250 AAAGTTTCTGGGCCTCCCTCAGG - Intergenic
962808828 3:138945472-138945494 ACACCCTCTGGGCCCGCCTCTGG - Exonic
963895593 3:150682351-150682373 AGAGCCTCTGGGCCTCTTTGTGG - Intronic
965080533 3:164025602-164025624 AAATCCTCTGGGTCTCCTGAAGG + Intergenic
965894340 3:173555914-173555936 AAAGCCTCTTGGCCTATTTCAGG + Intronic
966681213 3:182643798-182643820 GAGCCCTCTGGGCTTCATTCTGG + Intergenic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
968555804 4:1245887-1245909 AAACCAACTGGGCTTCCCTCAGG + Intronic
970691843 4:18629947-18629969 CAACCCTCCGGGTCCCCTTCTGG - Intergenic
974668887 4:65002235-65002257 AAAGCCTCTGAGCCTTCTTAGGG - Intergenic
977266340 4:94860222-94860244 AAAACCTTTGGTCCTCCTTTAGG + Intronic
979099579 4:116598655-116598677 CGATCCTCTGGGCCTCCTTGTGG - Intergenic
980791889 4:137631626-137631648 AAACCCTCTGGGCTTCACACAGG - Intergenic
981401791 4:144322044-144322066 AAACCCTCTGGGCCCTGTACAGG - Intergenic
982427205 4:155279029-155279051 AAATCCTCTTGGAATCCTTCTGG + Intergenic
986357172 5:6940095-6940117 AGATCCACTGGGCCTCCTGCTGG - Intergenic
991573517 5:68079579-68079601 AACCTCTCTGGGGCTACTTCAGG - Intergenic
1001010767 5:168095928-168095950 AACACCTCAGGGCCTCCCTCAGG + Intronic
1002204358 5:177553061-177553083 CAGCCCTCTGTGCCTCCCTCTGG - Intronic
1003984140 6:11418677-11418699 CAAATCTCTGGGCCTACTTCTGG - Intergenic
1004656303 6:17665282-17665304 AAACCATCTCTGACTCCTTCTGG - Exonic
1007119599 6:39369007-39369029 ACCCACTCTGGGCCTCCTTGGGG + Intronic
1007286481 6:40751509-40751531 ATACCTTCTGGGTCTCCTTTTGG + Intergenic
1010792288 6:80078411-80078433 AAACTCTCTGGGGCTCCCTCTGG - Intergenic
1012709281 6:102579156-102579178 AGACCCTCTCTGCCTGCTTCTGG - Intergenic
1017008674 6:150046899-150046921 AAACCCTCCTGGCCTACTCCTGG - Intergenic
1018937473 6:168283257-168283279 GAGCCCTCTGGGCCTCCTGTAGG + Intergenic
1019149995 6:169998884-169998906 AGAACTTCTGGGCCTCCTCCTGG - Intergenic
1020987674 7:15156478-15156500 AAACCCTCTGGGCTTAATGCAGG + Intergenic
1023785698 7:43705693-43705715 AAACCCTCTGGGCTCCATGCAGG + Intronic
1024002388 7:45199266-45199288 AAACCCACTGGCCCTGGTTCAGG + Intergenic
1026890170 7:73977233-73977255 AAACCTTCTGGCCCTGCTTTCGG - Intergenic
1027419412 7:78005032-78005054 TAAGCTTCTGGGACTCCTTCAGG - Intergenic
1028962649 7:96766769-96766791 GAACCCTATTGGCTTCCTTCTGG - Intergenic
1031106156 7:117545347-117545369 AAACCATATCAGCCTCCTTCTGG + Intronic
1031807460 7:126325990-126326012 AAACCATATGGGCCTCATTAGGG - Intergenic
1033055381 7:138047844-138047866 AAACCTTCTGGCCGTTCTTCAGG - Intronic
1035167852 7:157002414-157002436 GAGCCCCCTGGGCCTCCGTCTGG + Intronic
1039415370 8:37389264-37389286 AAACCCTCAGGGTCTCCTTCAGG + Intergenic
1039606353 8:38884047-38884069 AGACCCTCAGGGGCTCCCTCGGG + Intergenic
1039831419 8:41218156-41218178 AAAACCTTTGGGCCTCATTCAGG + Intergenic
1040086813 8:43351460-43351482 ACAGCCTCTGGGCCAGCTTCTGG - Intergenic
1040559756 8:48514157-48514179 CCACTCTCTGGGGCTCCTTCTGG + Intergenic
1041559493 8:59198910-59198932 TAACCATTTGGGGCTCCTTCAGG - Intergenic
1041633544 8:60116490-60116512 CATCCCTCAGGGCTTCCTTCAGG - Intergenic
1044389709 8:91635479-91635501 AAAGCCTCTGTGGCTCTTTCTGG + Intergenic
1045531324 8:102988018-102988040 AAACCCTCAGGGGCTTCATCTGG + Intergenic
1046098937 8:109592530-109592552 TGACCCTCTTGGCCTCCTTAAGG - Intronic
1048188654 8:132267514-132267536 AAAACCTCAGGGCCTCTTTATGG + Intronic
1056714811 9:89020438-89020460 CTTCCCTCTGGGCCTCCTTCAGG + Intronic
1059173697 9:112149992-112150014 AAACACTCTGGGCAAGCTTCTGG - Intronic
1061826002 9:133258539-133258561 AAGCCTGCTGGGCCTCCTTGTGG + Intronic
1061921350 9:133784204-133784226 AACCCCTCAGGGCCTCCCACAGG + Intronic
1187644103 X:21328199-21328221 AAACCCTCTGGGCTCCACTCTGG - Intergenic
1189302504 X:39962293-39962315 AAATCCGCTGGGGCCCCTTCTGG + Intergenic
1190604478 X:52126651-52126673 AAACCCTCTGGGCTCCATGCAGG - Intergenic
1191089590 X:56606009-56606031 AAACCCTCTGGGCTTCAGACTGG + Intergenic
1195971725 X:110480571-110480593 AAACCCTCTGGGCTCCATGCAGG + Intergenic
1197790359 X:130248464-130248486 AAACCCTCTGGGCTCCACTCTGG - Intronic
1198678163 X:139153081-139153103 GAATCCTCAGGGCCTACTTCTGG + Intronic
1199827865 X:151517100-151517122 AAACCCTCTGGGCTCCATGCAGG + Intergenic
1199843399 X:151673356-151673378 AAGCTCTCTGGACTTCCTTCTGG + Intronic
1202058756 Y:20863966-20863988 AAGGCCTCTGGTCCTCATTCAGG - Intergenic