ID: 1075042986

View in Genome Browser
Species Human (GRCh38)
Location 10:119123390-119123412
Sequence CAGGAAGAGGAGAAGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1987
Summary {0: 1, 1: 3, 2: 14, 3: 223, 4: 1746}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075042974_1075042986 24 Left 1075042974 10:119123343-119123365 CCTCTGTCCCTGATTAGCTGTAG 0: 1
1: 1
2: 0
3: 6
4: 146
Right 1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG 0: 1
1: 3
2: 14
3: 223
4: 1746
1075042978_1075042986 -5 Left 1075042978 10:119123372-119123394 CCCTCTTCATTTCCTTCTCAGGA 0: 1
1: 0
2: 4
3: 67
4: 680
Right 1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG 0: 1
1: 3
2: 14
3: 223
4: 1746
1075042976_1075042986 16 Left 1075042976 10:119123351-119123373 CCTGATTAGCTGTAGACTCTACC 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG 0: 1
1: 3
2: 14
3: 223
4: 1746
1075042975_1075042986 17 Left 1075042975 10:119123350-119123372 CCCTGATTAGCTGTAGACTCTAC 0: 1
1: 0
2: 0
3: 10
4: 73
Right 1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG 0: 1
1: 3
2: 14
3: 223
4: 1746
1075042979_1075042986 -6 Left 1075042979 10:119123373-119123395 CCTCTTCATTTCCTTCTCAGGAA 0: 1
1: 0
2: 2
3: 39
4: 473
Right 1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG 0: 1
1: 3
2: 14
3: 223
4: 1746

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075042986 Original CRISPR CAGGAAGAGGAGAAGGGGGC AGG Intronic
900118374 1:1038234-1038256 GAGGCAGAGGGGAAGGGGCCAGG + Intronic
900163226 1:1234396-1234418 CAGGAGGAAGAAACGGGGGCGGG + Exonic
900208326 1:1440977-1440999 AATGCAGAGGACAAGGGGGCTGG + Exonic
900247132 1:1641760-1641782 GAGGAAGAGGAGGAGGAGGAAGG - Exonic
900258356 1:1708892-1708914 GAGGAAGAGGAGGAGGAGGAAGG - Exonic
900419724 1:2550686-2550708 CAGGAAGAGGAGGAGGCAGCCGG + Intergenic
900710026 1:4107823-4107845 CAGGAGGAGGGGAAGAGGCCGGG - Intergenic
900736756 1:4304036-4304058 CAGGTTGTGGAGAAGGGAGCGGG - Intergenic
900786284 1:4652820-4652842 CATTAAGAGGCGAAGGAGGCAGG - Intergenic
900875821 1:5341780-5341802 CAGGCACAGGAGAGAGGGGCTGG + Intergenic
901055698 1:6447839-6447861 TAGGGAGAGGCGCAGGGGGCGGG + Intronic
901105382 1:6751857-6751879 GAGGAGGAGGAGGAGGGGGAGGG - Intergenic
901106572 1:6760912-6760934 CAAGAAAAGGAAAAAGGGGCCGG + Intergenic
901182628 1:7352125-7352147 AAGGAGGAGGAGAAGGAAGCAGG + Intronic
901272297 1:7961772-7961794 CAGGAAGAGGCGCGGGGTGCAGG + Intronic
901420325 1:9146338-9146360 CAGGAAGAGGAGGAGGAGGAAGG - Intergenic
901462948 1:9402360-9402382 CAGGCAGAGGTGTAGGGGGAAGG - Intergenic
901475313 1:9485394-9485416 GAGGAAGAGGAGAAGGGAGTGGG - Intergenic
901508379 1:9700990-9701012 GAGGAAGGGGAGTAGGGGGCAGG - Intronic
901529850 1:9846052-9846074 CTGGAAGAGGAGCAGGGGCAGGG + Intergenic
901753889 1:11429275-11429297 GAGAAAGGGGAGAAGGTGGCAGG + Intergenic
901767710 1:11514544-11514566 CTGGGAGGGGAGGAGGGGGCTGG - Intronic
901864858 1:12098851-12098873 CAGGAAGAGGATGAGGAGGTGGG - Intronic
902160990 1:14530207-14530229 CAGGAAGAGAAAACGGGAGCAGG + Intergenic
902199507 1:14823091-14823113 CAGAGGGAGGAGAACGGGGCTGG - Intronic
902288916 1:15424234-15424256 GAGGAAGACAAGATGGGGGCTGG - Intronic
902361595 1:15945127-15945149 GAGCAAGAGGAGGAGGGCGCAGG - Exonic
902478694 1:16700798-16700820 TAGGGAGAGGCGCAGGGGGCGGG - Intergenic
902680366 1:18039692-18039714 GAGAAAGCAGAGAAGGGGGCTGG + Intergenic
902770739 1:18644074-18644096 CTGGAAGAGGGGAAAGTGGCCGG - Intronic
902771456 1:18647495-18647517 GGGGGAGAGGAGAAGGAGGCAGG + Intronic
902795005 1:18795424-18795446 AAGGATGAGAAGGAGGGGGCTGG - Intergenic
902809572 1:18880458-18880480 GGGGATGTGGAGAAGGGGGCAGG - Intronic
902865133 1:19273105-19273127 CAGGAAGAGTACAAGGGGCAAGG - Intergenic
902867224 1:19287704-19287726 CAGGAAGAGTACAAGGGGCAAGG - Intronic
902922831 1:19677434-19677456 CAGGAAGAGGAGGAAGGGGTAGG - Intronic
903014355 1:20352242-20352264 GAGGAAGTGGAGAGGTGGGCAGG - Intronic
903021358 1:20397536-20397558 GAAGACAAGGAGAAGGGGGCTGG + Intergenic
903031344 1:20466343-20466365 CAGGAAGAAGGGCAGGTGGCTGG - Intergenic
903115619 1:21176525-21176547 GGGGAGGAGGAGGAGGGGGCCGG + Intronic
903131222 1:21280614-21280636 CAGGAAGAGGGGAAGCTGTCAGG + Intronic
903228332 1:21906470-21906492 AAGGAAGAAGAGGAAGGGGCAGG + Intronic
903231818 1:21926973-21926995 CAGGACCAGGAGGTGGGGGCCGG + Intronic
903283398 1:22262924-22262946 GAGGAAGAGGTCCAGGGGGCAGG + Intergenic
903352307 1:22725023-22725045 CACCAAGAGCAGAAGGGGGAGGG - Intronic
903436947 1:23357120-23357142 TAGGAACAGGAGAAGCAGGCAGG + Intergenic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
903581913 1:24377393-24377415 GAGCAAGAGGAGAAGGGAGAAGG - Intronic
903604611 1:24566509-24566531 AGGGAAGAGGAGACAGGGGCTGG + Intronic
903639384 1:24848259-24848281 CAGGAAGGAGGGAAGGAGGCCGG - Intergenic
903864761 1:26389918-26389940 CAGAATGAGGAGGAAGGGGCAGG + Intergenic
903934090 1:26882866-26882888 CAGGAAAAGGAGGAGGGAGCAGG - Intronic
903974252 1:27138768-27138790 CATGAAGTGGAGAAAGGGGTGGG + Intronic
904286026 1:29453798-29453820 GAGGAGGAGGAGAAGGAGGGGGG - Intergenic
904290448 1:29482232-29482254 AAGGAAGATGAGAATGGCGCTGG - Intergenic
904306565 1:29593921-29593943 AAGAGGGAGGAGAAGGGGGCAGG + Intergenic
904311200 1:29630729-29630751 AAGGAAGAGAAGAAGGGGGGGGG - Intergenic
904834238 1:33324567-33324589 CAGAAAGAGGGGAAGAGAGCGGG + Exonic
904910019 1:33927767-33927789 CAGGCAGAAGAGAAGGGAGCAGG - Intronic
904911497 1:33937603-33937625 GAGGAAGAGAGGAAGGGGGAGGG - Intronic
904941735 1:34168399-34168421 CAGGAGGAGGAGGATGGGGCTGG + Intronic
904970019 1:34412173-34412195 GAGGAAGAAGAGAGGGGGCCTGG + Intergenic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905285847 1:36879825-36879847 CAGAAAGAGGAGATGGGCTCTGG - Intronic
905357071 1:37392009-37392031 GAGCAAGAGAGGAAGGGGGCTGG - Intergenic
905510959 1:38519744-38519766 AAGGGAGAGGAGAAGGGAGGGGG + Intergenic
905811420 1:40916187-40916209 CAGGAAGAGAAAAAAGGGGGTGG - Intergenic
905825204 1:41021592-41021614 CAGGAAGAGGAGGAGAGGAGAGG + Exonic
905980565 1:42222007-42222029 GAGGAGAAGGAGAAGGGGGAGGG + Intronic
906180852 1:43817619-43817641 AAGGAGGAGGAGAAGGGAGGAGG - Intronic
906191973 1:43904758-43904780 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906191983 1:43904794-43904816 CAGGAAGAGGAACAGGAGGAGGG - Intronic
906191991 1:43904827-43904849 CAGGAATAGGAGCAGGAGGAGGG - Intronic
906192010 1:43904899-43904921 CGGGAAGAGGAGCAGGAGGAGGG - Intronic
906192249 1:43905754-43905776 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192337 1:43906081-43906103 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192381 1:43906225-43906247 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906516700 1:46443300-46443322 GAGGAAGAGGGGGAGGGGGAGGG - Intergenic
906781053 1:48573154-48573176 GGGGAAGAGCAGGAGGGGGCTGG - Intronic
907270615 1:53288800-53288822 AAAGGAGATGAGAAGGGGGCGGG - Intronic
907287385 1:53390536-53390558 CAGAAGGAGGAGAAGGGGAGTGG + Intergenic
907288500 1:53397366-53397388 GAGAAACAGGAGAAAGGGGCAGG - Intergenic
907389029 1:54144540-54144562 CAGGAGGAGGTGAAGGGCGGCGG + Exonic
907594063 1:55703665-55703687 AAGGAAGAGAAGAAGAGGGAAGG + Intergenic
907758908 1:57338319-57338341 CAGGAAGCAGAGAAGGGGAATGG - Intronic
907805157 1:57811391-57811413 GAGGAAGAGGAGATGGGCGTAGG - Intronic
907962582 1:59297052-59297074 GAGGAAGGGGAGGAGGAGGCAGG - Exonic
908179251 1:61587936-61587958 CAGAAAGCGGGGAATGGGGCTGG - Intergenic
908721040 1:67126255-67126277 CAGGAAGAGGAGCAGGCTGGAGG - Intronic
909566480 1:77058482-77058504 GAGGAAGAAGAGAAAGGGGGAGG - Intronic
909686546 1:78355211-78355233 AAGGAGGAGGAGAAAGGGGAGGG - Intronic
910076358 1:83284162-83284184 AAGGAAGAGGAGAAGGATGAGGG - Intergenic
910128516 1:83873823-83873845 CAGGAAGAGGAAAAGGAAGGTGG - Intronic
910636011 1:89408737-89408759 GAGGAGGAGGAGAAGGGGCTGGG - Intergenic
911474309 1:98357482-98357504 GAGGAGGAGGAGAAGGAGGGGGG - Intergenic
911591460 1:99752897-99752919 CAGGAACAGGACAAGGGGGCTGG + Intronic
911636185 1:100238381-100238403 GAGGAAGAGGAGGAAGGGACGGG - Intronic
911664592 1:100539030-100539052 GAGGAAGAGGAGTCGTGGGCGGG + Exonic
911773551 1:101778504-101778526 CAGGAAGGGTAGTAGGGGCCTGG - Intergenic
911820315 1:102411265-102411287 AAGGAGAAGGAGAAGGGGGGTGG + Intergenic
912416589 1:109512451-109512473 CAGAAAGAGGAAAGGGAGGCCGG - Intergenic
912512944 1:110200890-110200912 CAAGAGGAGGAGGAGGAGGCAGG - Exonic
912643499 1:111369539-111369561 TAGGGTGAGGAGAAGGGGGCAGG - Intergenic
912794949 1:112687618-112687640 CAGGAGGAGCAGAGGTGGGCAGG - Intronic
912812222 1:112803092-112803114 CAGGGAGTGGAGAGGAGGGCAGG - Intergenic
912860765 1:113211775-113211797 CAGGGAGGGGAGATGGGGGGAGG + Intergenic
912932738 1:113979524-113979546 CAAGATGAGGAGAGGGGTGCTGG - Exonic
912940290 1:114038930-114038952 CAGGAAGATGAGATGGGGCAGGG - Intergenic
913245233 1:116864936-116864958 GAGGAAGATGCGAAGGAGGCTGG - Intergenic
913451575 1:118996394-118996416 CAGCAAAAGGATAATGGGGCAGG + Intergenic
913458208 1:119055721-119055743 GAGGAGGAGGAGAAGAGGGAGGG + Intronic
913503869 1:119497846-119497868 CAGGAAGCGCACAAGGGGTCAGG + Intergenic
914000215 1:143687824-143687846 CATGAGGTGGAAAAGGGGGCAGG - Intergenic
914058050 1:144183173-144183195 GAGGAGGAGGAGGAGGGGGAAGG - Intergenic
914121095 1:144783192-144783214 AAGGAGGAGGAGGAGGGGGAAGG + Intergenic
914263615 1:146019622-146019644 GAGGAGGAGGAGGAGGAGGCCGG - Exonic
914716385 1:150258099-150258121 CAGGAAGGGGTGCAGGGGACTGG - Exonic
914937565 1:151993922-151993944 CAGGAAGAGGGGGAGGAGACAGG - Exonic
914942775 1:152037219-152037241 CAGGACGGGGTGGAGGGGGCCGG - Intronic
914993103 1:152515480-152515502 CAGCAGGAGGAGGAGGAGGCGGG - Exonic
914998660 1:152566592-152566614 CAGCAATGGGGGAAGGGGGCAGG - Intronic
914999218 1:152572918-152572940 TAGAAAGAGGAGATGGGGGTCGG + Intronic
915137050 1:153739904-153739926 CAGGAGGAGGAGACTGAGGCAGG - Intronic
915141232 1:153769869-153769891 CTGGGAGAGGAGAGGAGGGCAGG + Intronic
915145443 1:153793780-153793802 CTGGAAGCTGAGAAAGGGGCGGG + Intergenic
915333819 1:155129279-155129301 CTGGAGGAGGAGGAGGGGACAGG + Intronic
915361619 1:155289400-155289422 CAGGAGGAGTAGGAGGAGGCAGG + Exonic
915585892 1:156843745-156843767 CTGCAAGAGGAAAATGGGGCTGG - Intronic
915723081 1:157998236-157998258 CTGGCAAAGGAGAAGGGTGCAGG - Intronic
915935416 1:160087713-160087735 AAGGTGGAGGAGGAGGGGGCGGG + Exonic
915943876 1:160136001-160136023 CAGGAGGTGGAGGAGGGGACAGG + Intronic
915951118 1:160190532-160190554 GAGGAATAGGAGCAGGGGGCGGG - Intergenic
915953868 1:160207442-160207464 CAGGCAGAGCAGAGGAGGGCCGG - Intronic
916289136 1:163144635-163144657 GAGGAGGAGGAGGAGGGAGCTGG + Intronic
916407324 1:164510293-164510315 CAGGAAGAGGAGGAGGAGGTAGG - Intergenic
916524761 1:165598877-165598899 AAGGGAGAGGAGAAGAGGGGAGG + Intergenic
916577878 1:166083067-166083089 CAGGTAGAGGAGATGGGGAGTGG + Intronic
916881664 1:169024696-169024718 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
916888649 1:169095468-169095490 CAGGAAGTAGAGAAGGGTGGTGG + Intergenic
917333891 1:173909284-173909306 CAGGTAGAGGAGATGGGACCAGG - Intronic
917409350 1:174742099-174742121 GAAGAAGAGGAGGAGGGGGAGGG + Intronic
917409373 1:174742179-174742201 GAAGAAGAGGAGGAGGGGGAGGG + Intronic
917448247 1:175124807-175124829 AAGGAAGGGGAGAAGGAGGTAGG - Intronic
917823947 1:178796500-178796522 CAGGGAGAGGGCAATGGGGCTGG - Intronic
918002937 1:180514592-180514614 GAGGAAGAGGAGGAGGAGGGGGG + Intergenic
918095446 1:181330329-181330351 CAGGCAGAGAAGAAGGGGAGAGG - Intergenic
918118570 1:181517612-181517634 GAGGCAGAGGAAAAGGGAGCAGG + Intronic
918202663 1:182281680-182281702 CAGGAAGAGGAGAAGGGAGGTGG + Intergenic
918515214 1:185356112-185356134 CGGGAAGAGGAGAAGGGCCAAGG + Intergenic
918540935 1:185632318-185632340 CAGGAAGACTAGAAGTGGGGAGG - Intergenic
919098822 1:193068460-193068482 CAAGAAGAGGAGAAGAGAGAAGG + Intronic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919763355 1:201111944-201111966 GAGGAAGAGGAGGAGGGTGGGGG - Intronic
919988821 1:202694700-202694722 AAGGAAGAGGAGAAGGAGGAGGG - Intronic
920309697 1:205041860-205041882 CTGGAAAAGGAGAAGGAGTCGGG - Intergenic
920394076 1:205631515-205631537 CAGGAAGTGGGGGCGGGGGCCGG - Intronic
920404169 1:205696719-205696741 CAGGAAGAGTAGATGAGAGCAGG + Intergenic
920443108 1:205994510-205994532 CAGGAAGAAGAGATGGGGGTGGG + Intronic
920500055 1:206480187-206480209 CAGGAAGGGGAGATGGGTGGGGG + Intronic
921397084 1:214679859-214679881 GAGGAGGAGGAGAAGGGGGGAGG - Intergenic
921483722 1:215692308-215692330 CAGGAACAGGAGATGGTAGCTGG + Intronic
921734505 1:218612007-218612029 GAGGAGAAGGAGAAGGGGGTAGG - Intergenic
921734543 1:218612195-218612217 CAGGAAGAGGAAAAAGGTGGAGG - Intergenic
922025356 1:221743474-221743496 CAGGGAGAAGAGTAGGGGGCGGG + Intergenic
922172111 1:223164439-223164461 CAGGAAGGGAAGGAGGGGACAGG + Intergenic
922531309 1:226347346-226347368 AAGAAAGAGGGCAAGGGGGCTGG + Intergenic
922671368 1:227510626-227510648 AGGGAAGAGGAGGAGGAGGCAGG + Intergenic
922717752 1:227886084-227886106 CAGGAAGAGCAAAATGGGGTGGG + Intergenic
922936294 1:229425713-229425735 AAGAAAGAGGAGGAGGGGGGAGG + Intergenic
923265258 1:232307539-232307561 TTGGAAGAGGGGAAGGGTGCCGG - Intergenic
923342091 1:233016357-233016379 GGGGAGGAGGAGAAGGGGGAGGG - Intronic
923342101 1:233016378-233016400 CAAAAAGAGGAGAAAGGGGCAGG - Intronic
923534429 1:234838174-234838196 GAGGAGGAGGAGGAGGGGGGCGG + Intergenic
923658542 1:235939123-235939145 GAGGAGGAGGAGAAGGAGGGGGG + Intergenic
923835767 1:237609347-237609369 GGGGAAGGGGAGAAGGGGGGAGG - Intronic
924010742 1:239662945-239662967 AAGGAAGAGGAGAAAGGAGAAGG - Intronic
924260438 1:242224611-242224633 CAGTAACAGGACAAAGGGGCTGG - Intronic
924266956 1:242291995-242292017 CAGGAAGATGAGAGGGGTCCAGG + Intronic
924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG + Intronic
924617346 1:245623221-245623243 AAGGAAGAGGAGCTGGAGGCAGG - Intronic
924774172 1:247104152-247104174 CCCGAAGTGGAGAAGAGGGCTGG - Exonic
1062818971 10:519828-519850 CAAGTAGAGGAGCAGGGGGGAGG - Intronic
1062833467 10:621566-621588 GAGGAAGAGGAGGAGGAGGAAGG + Intronic
1063173369 10:3529754-3529776 GAGGAAGAGGAGGAGGGAGGAGG - Intergenic
1063267284 10:4467451-4467473 ATGGAAGAGGAGAAGGAGGGTGG - Intergenic
1063407800 10:5813419-5813441 CGGGAAGAGAAGAACTGGGCGGG + Exonic
1063438121 10:6050787-6050809 CAGGACGAGGAGGAGGAGGATGG + Intronic
1063480053 10:6367507-6367529 AAGGGAGAAGAGAAGGGTGCAGG + Intergenic
1063499020 10:6536595-6536617 GAGGAAGAGGAGAAGGGGAGCGG - Intronic
1063542594 10:6949482-6949504 AAGGAAGAGGAGAAGAAGGCAGG - Intergenic
1063929292 10:11013015-11013037 CAGGAAGAGGAGGGGGAGGATGG - Intronic
1063999695 10:11653383-11653405 AAGGAAGAAGAAAAGAGGGCGGG - Intergenic
1064001277 10:11665561-11665583 GAGGAGGAGGAGGAGGAGGCCGG - Intergenic
1064194550 10:13234407-13234429 GGGGGAGAGGAGGAGGGGGCTGG + Intergenic
1064784639 10:18880532-18880554 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1064789381 10:18938647-18938669 TAGGAAGAGTAGAAGGGGCTGGG + Intergenic
1065023000 10:21516534-21516556 GAGGAAGAGGAGGAGGAGGGGGG - Exonic
1065034608 10:21624971-21624993 GAGGAAGAGGAGGAAGGGGAGGG - Intronic
1065140390 10:22714132-22714154 GAGGAAGAGGAGGAGGAGGAAGG + Intronic
1065225595 10:23540593-23540615 AGGGAAGCAGAGAAGGGGGCTGG + Intergenic
1065328581 10:24571107-24571129 CAGAAAGAGCTGAGGGGGGCTGG + Intergenic
1065414384 10:25468541-25468563 CAGGTAGAGGAGAAGGAAGAAGG - Intronic
1065681792 10:28242849-28242871 CAGGAAGAGGAGGAGGGGAGAGG + Intronic
1065790301 10:29254351-29254373 GAGGAAGAGGAGGAGGAGGATGG + Intergenic
1066559254 10:36651357-36651379 GATGAAGAGGAGAAGGGGAAAGG - Intergenic
1066717861 10:38306501-38306523 CAGGAAGATGAGAGGGGTCCAGG - Intergenic
1067030354 10:42875464-42875486 GAGGAAGAGGGGACGGGTGCAGG - Intergenic
1067447100 10:46357823-46357845 TGGCATGAGGAGAAGGGGGCAGG - Intergenic
1067541937 10:47161123-47161145 AAAGAAGAAGAGGAGGGGGCCGG - Intergenic
1067876086 10:50009295-50009317 TAGCATGAGGAGAGGGGGGCGGG - Exonic
1068412668 10:56677743-56677765 AAGGAAGAGGAGGAGGAAGCAGG + Intergenic
1068453612 10:57226407-57226429 CAGGAAGAGCAGAAGTAGGGAGG + Intergenic
1068513791 10:58000674-58000696 AAGAAAGAGGAAAAGGAGGCAGG + Intergenic
1068707427 10:60092120-60092142 AAGGAAGATGAGAAGAGGGTAGG + Intronic
1068878384 10:62022354-62022376 CAGGAGGAAGATAAGGGGGAAGG + Intronic
1068932956 10:62610422-62610444 GAGGAGGAGGAGAAGGGGCTGGG - Intronic
1069274031 10:66567050-66567072 GAGAAAGAGGGGAAGGGGGAGGG + Intronic
1069487876 10:68836386-68836408 GAGGAAGAAGAGAATGGGTCTGG + Intronic
1069589485 10:69632962-69632984 CAGGAAGAGGAGCAGGATGGAGG - Exonic
1069619535 10:69828273-69828295 CAGGAGGAAGAGATGGGGGTGGG - Intronic
1069668746 10:70183624-70183646 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1069792193 10:71029959-71029981 CCGGAATTGGAGGAGGGGGCAGG + Intergenic
1069859359 10:71460856-71460878 CAGGAAGAGCAGAAGTGAGTGGG + Intronic
1070148445 10:73791227-73791249 CAGCAAGAGGAGGATGAGGCAGG - Intronic
1070158135 10:73848958-73848980 CAGGAAGAGGAGGAAGGGCGGGG + Intronic
1070362377 10:75703254-75703276 CAGGAAGGGAAGAAGGGAGAAGG + Intronic
1070516906 10:77216369-77216391 GGGGAAGAGGAGAAGTGGGAAGG + Intronic
1070598586 10:77849722-77849744 CAGGAAAGGGAGAGGGGGACAGG + Intronic
1070794743 10:79210061-79210083 CACAAAGAGGATTAGGGGGCTGG - Intronic
1070835865 10:79446480-79446502 CAGAAATAGGAGAAGGGGGGGGG - Intergenic
1071203812 10:83251730-83251752 GAGGAAGAGGAGGAGGAGGGAGG + Intergenic
1071290082 10:84182225-84182247 AAGGAGGAGGTGAAGAGGGCTGG + Intronic
1071600411 10:86956141-86956163 CGGCAAGGGGAGCAGGGGGCGGG - Intronic
1071676410 10:87659796-87659818 GAGGAGTAGGAGAAGGGGGCTGG + Exonic
1072614772 10:97042253-97042275 CCAGAAGCGGAGAAGGGGGCTGG + Intronic
1072724833 10:97806226-97806248 CAAGAACATGAGAATGGGGCAGG - Intergenic
1072727163 10:97821839-97821861 CAGGAGCAGGAAAGGGGGGCAGG + Intergenic
1072767123 10:98104246-98104268 CAGGAAGGGGAGAAGAGGGGAGG - Intergenic
1072785000 10:98273404-98273426 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1073050580 10:100664559-100664581 AGGGGAGAAGAGAAGGGGGCAGG + Intergenic
1073152744 10:101323008-101323030 CAGGGAGAGGAGCAGGAGGAGGG + Intergenic
1073336514 10:102714289-102714311 CAGGAGGAGGAGGAGGAGGAGGG - Exonic
1073353661 10:102837021-102837043 CAGGGGGTGGTGAAGGGGGCAGG + Intronic
1073439339 10:103543496-103543518 GAGGAAGAGGAGGAGGAGGGAGG - Intronic
1073530949 10:104231886-104231908 AAGGAAGAGATGAAGGGTGCAGG + Intronic
1073581124 10:104666352-104666374 CAGGAGGAGGAGAAGAGGAAAGG + Intronic
1073592120 10:104767605-104767627 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1073753429 10:106555753-106555775 CAGGAAGAAGTGCAGGGGCCTGG + Intergenic
1073998329 10:109341424-109341446 TAGGAGGAGAAGAATGGGGCGGG + Intergenic
1074187991 10:111113569-111113591 TAGGAAGAGGAAAAGAGGGCTGG + Intergenic
1074329769 10:112494490-112494512 AAGGAAGAGGAAAGGAGGGCAGG - Intronic
1074359339 10:112812701-112812723 GAGGAAGAGTAGAAGGGGATGGG - Intronic
1074765167 10:116695001-116695023 CAGTAAGGGGACAAGGGGACAGG - Intronic
1074827998 10:117228495-117228517 AAGGAAGGGGAGAAGGAGGGAGG - Intergenic
1074975569 10:118578548-118578570 CAGGAAGAGGCAATGGAGGCTGG + Intergenic
1075002927 10:118811062-118811084 CGGGACCAGGAGAATGGGGCAGG - Intergenic
1075041835 10:119114188-119114210 CAGGAAGCAGAGGAGGCGGCTGG - Intronic
1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG + Intronic
1075161664 10:120029648-120029670 GAGGAGGAGGGGAAGGGGGAAGG + Intergenic
1075185459 10:120252087-120252109 CCGGAAGTGGGGAAGGGGGTGGG + Intergenic
1075231583 10:120684549-120684571 CAGGAAGTGGGGCGGGGGGCGGG - Intergenic
1075274203 10:121078843-121078865 CAGGAATGTGCGAAGGGGGCAGG - Intergenic
1075304296 10:121354309-121354331 CAGGGAGGAGAGAAGAGGGCAGG - Intergenic
1075450613 10:122549524-122549546 GAGGGAGAGGAGAAGGGGACAGG + Intergenic
1075576491 10:123581425-123581447 CAAGAAGAGGTGGAGGGAGCAGG - Intergenic
1075578180 10:123596205-123596227 GAGGAAGAGGACAAAGGGTCTGG + Intergenic
1076070228 10:127482962-127482984 CAGGGAGTGGACAAGGGGGAAGG - Intergenic
1076131213 10:128015245-128015267 TATCAAGAGGAGAATGGGGCCGG + Intronic
1076222500 10:128745763-128745785 CTGATAGGGGAGAAGGGGGCAGG + Intergenic
1076318935 10:129564354-129564376 AAGGAAGAGGAGGAGGAGGAAGG - Intronic
1076346038 10:129779872-129779894 CGGGAAGAGGAGAAGGGAGAGGG - Intergenic
1076346059 10:129779956-129779978 GGGGAAGAGGAGAAGGGAGAGGG - Intergenic
1076346066 10:129779977-129779999 GGGGAAGAGGAGAAGGGAGAGGG - Intergenic
1076346073 10:129779998-129780020 GGGGAAGAGGAGAAGGGAGAGGG - Intergenic
1076350441 10:129811546-129811568 CAGCACCGGGAGAAGGGGGCAGG - Intergenic
1076471014 10:130718255-130718277 AAGGAAGAAGAGAAGGGAGTGGG + Intergenic
1076513758 10:131031540-131031562 GAGGAAGTGGTCAAGGGGGCGGG + Intergenic
1076517746 10:131058119-131058141 CTGGAAGAGAAGAAGGGAGAGGG + Intergenic
1076528210 10:131126115-131126137 CCGGAAGAGGTGAAGCGAGCAGG - Intronic
1076730404 10:132436269-132436291 CATCAAGTGGAGAAGGGGCCTGG - Intergenic
1076858287 10:133127971-133127993 CAGGAAGAGGTGAAGTGGGGTGG - Intronic
1077365686 11:2160696-2160718 CAGCATGGGCAGAAGGGGGCAGG - Intronic
1077550063 11:3196280-3196302 CATGCAGGAGAGAAGGGGGCCGG + Intergenic
1077761745 11:5107713-5107735 GAAGAAGAGGAGGAGGGGGAGGG + Intergenic
1077889800 11:6410884-6410906 GAGGGAGAGGAGAAGGCGGCCGG - Exonic
1077902749 11:6502941-6502963 CAGGGGGAGGAGAAGGGGCCTGG - Intronic
1077941062 11:6844063-6844085 AAGGAAGAGGAAAAGGGGCAAGG - Intergenic
1078059725 11:8035457-8035479 CAGTAAGAGCTGAAGGGAGCAGG - Intronic
1078155647 11:8797744-8797766 CAGGAAAAAGAGTAGGGTGCTGG - Intronic
1078333178 11:10442799-10442821 AAGGAAGAGGCGGAGGCGGCCGG - Intronic
1078375717 11:10791763-10791785 GAGGCTGAGGAGAAGGGCGCCGG - Intergenic
1078444686 11:11395321-11395343 CAGGAAGAAGGAAAGGGGACAGG + Intronic
1078562846 11:12388153-12388175 CACCAAGAGGAGAAGATGGCTGG + Intronic
1078697026 11:13644588-13644610 GAGGAAGAGGGGAAAGGGGGAGG + Intergenic
1078733041 11:13993257-13993279 AAGGCCGAGGAGAAGGGGGTGGG + Intronic
1078794517 11:14578692-14578714 CAGGAAGTAGAGAAGGTTGCAGG + Intronic
1079172080 11:18105977-18105999 GAGGAGGAGGAGGAGGTGGCCGG - Exonic
1079190202 11:18270628-18270650 CAGGAGGTCGAGAAGGGGACAGG - Intergenic
1079997284 11:27307509-27307531 CAGGAAGAAAAGAAGAGAGCTGG + Intergenic
1080365832 11:31573021-31573043 AAGGAGGGAGAGAAGGGGGCAGG + Intronic
1080575384 11:33594190-33594212 CAGGAAGAGGAACAGAGGGTTGG + Intronic
1081057936 11:38433762-38433784 CAGGAAGAAATGAAGGGTGCTGG + Intergenic
1081666457 11:44919761-44919783 CAGGAGGAGGACACAGGGGCGGG - Intronic
1081743228 11:45455445-45455467 TAAGAAGAGGTGAAGGTGGCAGG - Intergenic
1081871079 11:46382751-46382773 CAGCGAAAGGAGAAGGGGGTGGG + Intronic
1081906723 11:46675020-46675042 CAGGAAGAGTAGAAGAGCCCCGG + Intergenic
1082044713 11:47715382-47715404 CAGGAAGCGGAGAAAGGGCGGGG + Intronic
1082762064 11:57136792-57136814 GAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083478334 11:62928001-62928023 CCAGAAGAGGAGAAGGAGGCAGG - Intergenic
1083571962 11:63765836-63765858 GAGGAGGAGGAGGAGGGGGCCGG - Exonic
1083672591 11:64307330-64307352 AAGGAAGAGGAGGATGGGGAGGG + Exonic
1083745985 11:64736734-64736756 CACGGTGAGGAGCAGGGGGCAGG - Exonic
1083751955 11:64765922-64765944 GAGGCGGAGGAGGAGGGGGCGGG + Intronic
1083990820 11:66244666-66244688 CAGAGAGAGGAGATGGGGGTGGG + Exonic
1084190950 11:67498517-67498539 CAGGGAGCGGGGAAGGGGTCAGG - Intronic
1084421196 11:69061529-69061551 CAGAGAGAGGAGGTGGGGGCAGG + Intronic
1084427967 11:69095906-69095928 CAGGAGGAGGAGGAAGAGGCTGG + Intergenic
1084502741 11:69544517-69544539 AAGGAGGAGGAGAAGCAGGCAGG + Intergenic
1084514668 11:69630125-69630147 CAGGAAGAGGAAAAGGAGAAGGG + Intergenic
1084571662 11:69963417-69963439 AAGGAGGAGGAGGAGGGGGAAGG + Intergenic
1084760680 11:71268741-71268763 GAGGAGGAGGAGAAGGGAGGAGG + Intergenic
1084785817 11:71441095-71441117 GTGGAAGAGGAGGAGGGGGATGG - Intronic
1084860508 11:72014930-72014952 GAGGCAAAGGAGAAGGTGGCAGG - Exonic
1084941977 11:72617829-72617851 CAGAGAGAGGGAAAGGGGGCAGG - Intronic
1085023528 11:73223516-73223538 GAGGAATAAGACAAGGGGGCAGG - Intronic
1085310040 11:75510753-75510775 CCGGAGGAGGAGGAGGGGGGAGG - Intronic
1085417703 11:76330247-76330269 CTGGGAGGGGAGGAGGGGGCTGG - Intergenic
1085448034 11:76614481-76614503 CTGTAAGAGGAGAATAGGGCAGG - Intergenic
1085532341 11:77199375-77199397 CAGGCAAAGGAGAAGTAGGCCGG + Intronic
1085740530 11:79074710-79074732 CACCAGGAGGAGATGGGGGCAGG + Intronic
1085773148 11:79342435-79342457 CAGGAGGAGGCGAAGAGGGTGGG + Intronic
1086078880 11:82882122-82882144 CAGGAGGAGGAGAAAGAGGAGGG + Intronic
1086084482 11:82940697-82940719 CAGGAGCAAGAGTAGGGGGCAGG + Intronic
1086111962 11:83208803-83208825 CAGGCAGTTGAAAAGGGGGCTGG + Intronic
1086302934 11:85448917-85448939 AAGGAAGAGGAGGAGGGAGAGGG - Intronic
1086499122 11:87434177-87434199 GAGGATGAAGAGAAGAGGGCTGG + Intergenic
1086598182 11:88600238-88600260 GAGGAAGAGGAGGAGGAGGAAGG - Intronic
1086827630 11:91519047-91519069 GAGAAAGAGGAGAAGGAGGAGGG + Intergenic
1087009296 11:93498486-93498508 CCACAAGCGGAGAAGGGGGCTGG + Intronic
1088087377 11:105997179-105997201 GAAGAAGAGGAGGAGGGGGAAGG + Intronic
1088559582 11:111099099-111099121 CAGGAAGAGGAGGCGGGGGAGGG + Intergenic
1088889041 11:114030440-114030462 CAGAGAGAGGCCAAGGGGGCAGG - Intergenic
1088907745 11:114167647-114167669 CTGGGAGAGCAGGAGGGGGCTGG - Intronic
1088924418 11:114285794-114285816 CAGGAAGAGGTGAAGGGAGCAGG + Intronic
1088995409 11:114991702-114991724 CTGGAAGAGGAGAGGGCGGGTGG - Intergenic
1089072245 11:115709755-115709777 AATCAAGAGAAGAAGGGGGCAGG - Intergenic
1089083650 11:115798605-115798627 CAGGAAGAGGAGGAGGACGGGGG - Intergenic
1089183455 11:116598713-116598735 CATGAAAGGGAGAAGGGGCCTGG + Intergenic
1089346896 11:117796709-117796731 CAGGAAGAGGGCAAGGGGCTGGG + Intronic
1089413318 11:118265451-118265473 CAGGAACAAGAGAAGGCGGCAGG + Intergenic
1089513791 11:119018683-119018705 GAGGAGGAGGAGGAGGAGGCTGG + Exonic
1089550499 11:119272414-119272436 CATTAAGAGCAGAATGGGGCTGG - Intronic
1089625402 11:119747967-119747989 CAGGAAGAGGAGGAGAGAGGTGG + Intergenic
1089702988 11:120256701-120256723 CAGGAAGAAGGGGAGGGAGCTGG + Intronic
1089751677 11:120655830-120655852 TAGGAGGAGGAGCAGGTGGCGGG + Intronic
1090029445 11:123194914-123194936 TAGCAAGAGGAGAAGGAGGAGGG + Exonic
1090079510 11:123602587-123602609 GAGGAAGGGGAGAAGGTGGCAGG - Intronic
1090131832 11:124150779-124150801 CAGGAAGACGAGAAAGAGGAAGG + Intergenic
1090167802 11:124569967-124569989 CAGGACGAGGGGAGGAGGGCGGG + Intergenic
1090449872 11:126796948-126796970 CAGGAAGTGGGGAAGGGACCAGG + Intronic
1090484646 11:127102203-127102225 GAGGGAGAGGAGGAGAGGGCAGG - Intergenic
1090703229 11:129314795-129314817 GAGGGAGAGGGGAAGGGGGAAGG - Intergenic
1090817948 11:130314943-130314965 GAAGGGGAGGAGAAGGGGGCGGG + Intergenic
1090819304 11:130326663-130326685 AAGCGAGAGGAGAAGGGGTCCGG - Intergenic
1090862449 11:130666130-130666152 AAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1090976841 11:131686514-131686536 GAGGAAGAGGAGGAGGAGGAAGG + Intronic
1091179338 11:133589305-133589327 CAGGGAGAGGAGATAGGGCCGGG + Intergenic
1091203424 11:133800428-133800450 TGACAAGAGGAGAAGGGGGCAGG + Intergenic
1091326324 11:134691330-134691352 GAGGAAACGGAAAAGGGGGCAGG - Intergenic
1091390939 12:125748-125770 CAGGAGGAGGAGGAGCGGCCGGG + Exonic
1091557138 12:1582410-1582432 CAAGAAGAAGAAAACGGGGCTGG - Intronic
1091584591 12:1808905-1808927 CATGAAAGGGAGAAGGGGGAGGG + Intronic
1091632810 12:2174956-2174978 TAGGAAGAGGAGGAGGAGGAGGG + Intronic
1091635550 12:2194096-2194118 CAGGAGGAGGAGGACGGGGCAGG - Intronic
1091688726 12:2581652-2581674 GAGGAAGAGGAGAAGGAGCAGGG - Exonic
1091690983 12:2597298-2597320 CAGGAGGAGCAGAAGGGGATGGG - Intronic
1091718196 12:2794747-2794769 CAGGAGAAGGGGGAGGGGGCAGG + Intergenic
1092061948 12:5558160-5558182 CAGGAGGAAGATAAGGGGGACGG - Intronic
1092256326 12:6928280-6928302 CGAGAAGAGGAGAGGGGGGCGGG + Intronic
1092507364 12:9117341-9117363 CAGGAAGACCAGATGGGAGCTGG + Intergenic
1093084575 12:14852460-14852482 AAGGAGGAGGAGGAGGGGGAGGG - Intronic
1093417400 12:18935470-18935492 CAAGCAGAGGAGAAGGCTGCAGG + Intergenic
1093658227 12:21722344-21722366 AAGGAAGAGGACAAGGGGAGAGG - Intronic
1093844525 12:23952197-23952219 CAGGAAGAGGAGGAGGCGGGAGG + Intergenic
1093917660 12:24823686-24823708 CAGGAGGAGGAGAGGGAGGGTGG - Intronic
1094030326 12:26004711-26004733 GAGGAAGAGGAGGAGGAGGAAGG + Intronic
1094185458 12:27637682-27637704 CAAGAAGAAGAGAGGAGGGCTGG + Intronic
1094200276 12:27788015-27788037 TAGGAAGGGGAGAAGGGGAAAGG - Intronic
1094337789 12:29380599-29380621 TCGGAAAATGAGAAGGGGGCGGG - Intronic
1094754643 12:33453872-33453894 CAGGATCTGGGGAAGGGGGCAGG + Intergenic
1094855552 12:34401260-34401282 CAGGAAGAGTTGAAAGGGGAGGG + Intergenic
1095326779 12:40904311-40904333 AAGGAAAAAGAGAAGAGGGCTGG - Intronic
1095740034 12:45596912-45596934 CAGGAAGATGAGAATGAGGTGGG - Intergenic
1095774695 12:45999593-45999615 GAGGAAGAGGGGGAGGGGGAGGG - Intergenic
1095958767 12:47820670-47820692 GAGGAAGAGGAGAGGAGGGAAGG - Intronic
1095967980 12:47882400-47882422 GAGAAAGAGGAGATGGGGGCTGG + Intronic
1095982641 12:47981842-47981864 CAGGTAGAGGTGAGGGAGGCAGG + Intronic
1096256050 12:50063080-50063102 CAGGAAGAAAAGGAGGTGGCCGG - Intronic
1096665174 12:53159772-53159794 CAGGGAGAGGGGAAAGGGGCAGG - Intronic
1096718908 12:53506940-53506962 GAGGAAGAGGAGAAGGAAGGGGG - Intronic
1096968215 12:55645652-55645674 AAGGAAGAGAAGAATGGGGAAGG - Intergenic
1097014274 12:55974254-55974276 CGGAGAGGGGAGAAGGGGGCCGG + Intronic
1097107422 12:56634026-56634048 CTTAAAGGGGAGAAGGGGGCCGG - Intronic
1097176142 12:57144091-57144113 CAGGGAGATGGGAAGGGGACCGG - Intronic
1097616641 12:61891682-61891704 TAGGAGGAGGAGAAGGAGGAGGG + Intronic
1097644520 12:62220809-62220831 AAGAAAGAAGGGAAGGGGGCCGG + Intronic
1097776152 12:63648690-63648712 AAGGAAGGGGAAAAGGGGGAAGG - Intronic
1098305596 12:69099467-69099489 GAGGCAGAGAAGAAGGGGGCGGG + Intergenic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098890495 12:76005538-76005560 CTGGAAGAGGAAAAGAGGGAGGG - Intergenic
1099009252 12:77272167-77272189 CAGGAAGAGGAGTGGGGGCCAGG + Intergenic
1099163849 12:79276968-79276990 GAGGAAGAGGAGGAGGAGGAGGG + Intronic
1099659979 12:85545148-85545170 AAGGAGGAGGAGAAGGTAGCAGG - Intergenic
1099764001 12:86959470-86959492 CAGGAAGTAGAGAAGGAGACGGG - Intergenic
1099959182 12:89380414-89380436 GAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1100282415 12:93130542-93130564 CAGGAAGAGGGAAAGGGGTCAGG - Intergenic
1100455176 12:94744795-94744817 CAGAAATCGGAGAAGGGGGAGGG - Intergenic
1101064533 12:101005920-101005942 CTGGAAGAAGAGGAGGAGGCAGG - Intronic
1101359685 12:104014582-104014604 CAGGGAGAGGAGAAAGAGGGTGG + Intronic
1101718121 12:107328946-107328968 CAGGGAGAGGGGAAGCCGGCGGG - Intronic
1101723495 12:107371004-107371026 AGGGAGGAGGAGAAGGGGGGTGG - Intronic
1101904114 12:108812547-108812569 CAGGCGGAGGTCAAGGGGGCAGG + Intronic
1102039839 12:109793875-109793897 CAGGAAGAGAAGAGGAGGGCAGG + Intronic
1102159575 12:110757571-110757593 CAGAAAAATGGGAAGGGGGCTGG - Intergenic
1102226873 12:111235013-111235035 CAGAAAGAGAGGAAGTGGGCTGG - Intronic
1102230253 12:111257261-111257283 GAGGAAGAGGAAAAGGGAGGAGG - Intronic
1102230406 12:111257776-111257798 CAGGAAGAGGAGGAGGAGGATGG - Intronic
1102408798 12:112698918-112698940 GAGGAGGAGGAGAAGGGCGGGGG - Intronic
1102471917 12:113164080-113164102 AAGGAGGAGGAGGAGGAGGCGGG - Exonic
1102572623 12:113836248-113836270 CAGGAAGAGGACAGGGGAGATGG + Intronic
1102598035 12:114007777-114007799 CAGGAGTAGAAGCAGGGGGCTGG - Intergenic
1102678800 12:114676243-114676265 CTGGAAGAGTTGAAGGGGGATGG - Intronic
1102735882 12:115159051-115159073 CAGGAAGATGTCAAGGGGGAAGG - Intergenic
1102746220 12:115251269-115251291 AAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1102746235 12:115251366-115251388 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1102746249 12:115251457-115251479 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1102780854 12:115563329-115563351 CAGGAAAAGGATGAGGTGGCGGG - Intergenic
1102808101 12:115799714-115799736 GAGGAAGAGGAGGAGGGGGAGGG + Intergenic
1102822962 12:115923841-115923863 GAGGAGAAGGAGAAGGGGGTGGG - Intergenic
1102935505 12:116893152-116893174 TTGAAAGAGGAGAAGTGGGCTGG - Intergenic
1103005088 12:117414632-117414654 CAGGAAGAGGAGGAGGAAGGAGG - Intronic
1103091705 12:118102781-118102803 CAGGGAGAGGAGATGGAGCCAGG - Intronic
1103162858 12:118744556-118744578 CAAGAAGAGGAGCAGTGGGGAGG + Intergenic
1103235392 12:119368216-119368238 GAGGAAGAGGAGGAGGAGGAGGG + Intronic
1103265470 12:119626509-119626531 GAGGAGGAGGAGAAGGGAGAAGG + Intronic
1103514200 12:121496374-121496396 CAGGAAGAGCAGAAGCGCTCAGG + Intronic
1103527851 12:121579517-121579539 CAAGAAGAGGAGGTGGGGGGAGG + Intronic
1103582107 12:121923124-121923146 CAGGAAGGGGAGGAGAGGGGAGG - Intronic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1103947103 12:124532733-124532755 GAGGCAGAGGAGGAGGAGGCTGG + Intronic
1103954275 12:124567636-124567658 CGGGAGGGGGAGGAGGGGGCGGG + Intergenic
1104091471 12:125521314-125521336 AAGGAAAAGGAGAAGGGGAAGGG - Intronic
1104316236 12:127704425-127704447 GAGGAAGAGGAGAAGGAGATTGG + Intergenic
1104374392 12:128251004-128251026 GAGGAAGAAGAGAAGGGGAAGGG + Intergenic
1104512994 12:129398569-129398591 CAGGCAAAGGAGGAGGGGGTTGG + Intronic
1104649708 12:130522706-130522728 CAGGGAGAGGAGGAGGAGGTGGG + Intronic
1104926933 12:132318720-132318742 CAGGCAGACGAGAGGAGGGCAGG - Intronic
1104950988 12:132439927-132439949 CCGGAAATGGAGAAGGTGGCTGG + Intergenic
1104956021 12:132466204-132466226 GAGGAAGAGGAGGAGGGGGACGG - Intergenic
1105265262 13:18809392-18809414 CAGGAGGAAGAGAAGAGAGCAGG + Intergenic
1105344574 13:19561086-19561108 AAGGAAGAGGAGGATGGGGAGGG - Intergenic
1105544874 13:21344014-21344036 AAGGAAGAGGAGGAGGAGGCGGG - Intergenic
1105591501 13:21796830-21796852 CAGGGAGAGGAGAAGAAGGCAGG - Intergenic
1105831404 13:24165540-24165562 CTGAGAGAGGAGAAGAGGGCAGG - Intronic
1105893144 13:24696408-24696430 TAGAAAGGGGAGAGGGGGGCCGG + Intronic
1105898483 13:24738375-24738397 CAGGGAGAACAGAAGGGGCCTGG - Intergenic
1106194312 13:27480272-27480294 AAGGAATAGGAGAGGAGGGCTGG + Intergenic
1106301300 13:28468691-28468713 CAGGAACAAGAGAAGGGGGGAGG - Intronic
1106391640 13:29339820-29339842 CTGGGAGCGGAGAAGGGGCCTGG + Intronic
1106513978 13:30436805-30436827 AAGAAAGAGGAAAAGGAGGCTGG - Intergenic
1106751303 13:32771610-32771632 CAGGAAGAGGAAAAGTTGCCTGG + Intronic
1106765840 13:32913404-32913426 GAGGAAGAGGAGAAGGCAGAGGG - Intergenic
1107401974 13:40077970-40077992 CAGGTAGAAGAGAGGGAGGCAGG + Intergenic
1107644451 13:42479440-42479462 CTGGAAGAAGATCAGGGGGCTGG + Intergenic
1107662962 13:42658443-42658465 CAGGAAGATGTGCAGGTGGCTGG - Intergenic
1107879702 13:44822299-44822321 AAAGAGGAGGAGGAGGGGGCGGG - Intergenic
1107890061 13:44906260-44906282 CAGGAGGAGGAGGAGGGAGGAGG + Intergenic
1107907393 13:45073936-45073958 GAGCAGGAGGAAAAGGGGGCGGG + Intergenic
1108007512 13:45965279-45965301 CAGGATGAGGAGAAGATGCCAGG - Exonic
1108096504 13:46907375-46907397 AAAGAAGAGGAGAAGAGGGGAGG - Intergenic
1108134022 13:47335459-47335481 AAGAAATAGGAAAAGGGGGCCGG - Intergenic
1108302386 13:49091663-49091685 CAGGAAGAGAAGATAGGGCCTGG - Intronic
1108343652 13:49522644-49522666 CAGGAGGAGGTGAAGGTTGCTGG - Intronic
1108392059 13:49956273-49956295 GAGGAAGGGGAGGAGGGGGAGGG - Intergenic
1108692901 13:52875812-52875834 CAGGAGGAGGGGCAGGGGGAAGG - Intergenic
1108730662 13:53232127-53232149 CATAAAGAGAAGAAGGAGGCGGG + Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1109181545 13:59219986-59220008 GAGGAAGGGGGGAAGGGGGAAGG + Intergenic
1109340774 13:61055484-61055506 CAGGAAGAGGAAAATGGGAGAGG + Intergenic
1110066247 13:71110065-71110087 GAGGCAGAAGAAAAGGGGGCAGG - Intergenic
1110436537 13:75482388-75482410 CAGGAGGAGGAGCAGCGAGCTGG - Intergenic
1110444168 13:75558914-75558936 CAGGAAGTGGAGAAAGGAGCAGG + Intronic
1110605526 13:77427564-77427586 TAAGAAGAGGAGAATAGGGCCGG - Intergenic
1111622851 13:90746719-90746741 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
1112561441 13:100518347-100518369 CAGGAAGAAGAGATGTGGGGTGG + Intronic
1113421673 13:110175951-110175973 CGGGAAGAGGAGGAGAGTGCGGG - Intronic
1113673971 13:112195793-112195815 AAGGAAGAGGGGAAGGAGGGGGG - Intergenic
1113814474 13:113161753-113161775 CAGGAGGAGGACGGGGGGGCAGG - Intronic
1113897330 13:113774121-113774143 TAGGAAGAGAAGAAGCAGGCGGG - Intronic
1113909679 13:113836254-113836276 GAGGAAGAGGAGGAGGAGGAGGG + Intronic
1113909687 13:113836269-113836291 GAGGAGGGGGAGAAGGGGGAGGG + Intronic
1114269079 14:21090582-21090604 CAGGAAGGGGAGGAGGGCTCCGG - Exonic
1114554105 14:23551649-23551671 GAGGAGGAGGAGGAGGAGGCAGG - Exonic
1115026701 14:28755408-28755430 CAAGAAAAGAAGAAGGGGGCAGG + Intergenic
1115028493 14:28767736-28767758 GGGGAGGAGAAGAAGGGGGCGGG + Exonic
1115098285 14:29666406-29666428 CAGGAAGAGGAGAAGAGAGATGG - Intronic
1115190026 14:30738086-30738108 GAGGAGGAAGGGAAGGGGGCGGG + Intergenic
1115275594 14:31605788-31605810 GAGGAAGAGGAGGAGGAGGAAGG - Intronic
1115298874 14:31861565-31861587 AAGAAGGAGGAGAAGAGGGCAGG - Intergenic
1115659130 14:35474595-35474617 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1115761717 14:36582848-36582870 CAGGAGGAGGAGGAGGAAGCTGG - Intergenic
1116494078 14:45539406-45539428 TAGGAAGAGTAGAGGGAGGCAGG - Intergenic
1117337195 14:54765738-54765760 AGGGAAGTGGAGAAGGGGCCTGG - Intronic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1117595846 14:57326449-57326471 CAGGGAGAGGAAAAAGGGGAAGG - Intergenic
1117662475 14:58021700-58021722 CAGCCAGAGGAGAAAGGGCCAGG + Intronic
1117903049 14:60555194-60555216 TAGGAAGGGGAGTGGGGGGCTGG + Intergenic
1117911511 14:60642164-60642186 CAGGAAGCGAAGAAGGAGACAGG + Intergenic
1117931471 14:60846147-60846169 AAGGAATAGGAGAATGGGGAAGG - Intronic
1118153840 14:63218959-63218981 GAGGAAGAGTAGAAGAGGGTTGG + Intronic
1118171860 14:63395952-63395974 GAAGAGGAGGAGAAGGGGGAGGG + Intronic
1118290406 14:64515893-64515915 CAGGTAGAGGAGTATGCGGCAGG - Intronic
1118459559 14:65976053-65976075 GGGGAAGAGGAGAAGGGGGAAGG + Intronic
1118632468 14:67718291-67718313 AGGGAAGAGGAGAAGGAGGAAGG + Intronic
1118708169 14:68499069-68499091 CAAGAAGAGGAGAAGGTGAAGGG + Intronic
1118735269 14:68696599-68696621 CAGTGAGAGGAGCAGAGGGCTGG - Intronic
1118854360 14:69610080-69610102 CAGGGAGGGGACAAGGGGGAAGG - Intergenic
1118900398 14:69981063-69981085 AAGGCAGAGCAGAAGGAGGCTGG + Intronic
1118982408 14:70727475-70727497 AAGGCAGAGGAAAGGGGGGCCGG + Intronic
1119119802 14:72064172-72064194 CTGGAAGAGGTGAAGGAGGAGGG + Intronic
1119123022 14:72097573-72097595 GAAGAGGAGGAGAAGGGGGCGGG + Intronic
1119180363 14:72600984-72601006 GAGGAAGAGGAGGAGGAGGGGGG + Intergenic
1119484287 14:74978005-74978027 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1119618626 14:76114942-76114964 GAGGAAGAGGACAAGGGGAATGG + Intergenic
1119747118 14:77052480-77052502 CCGGAAGAGGGGCAGGGAGCCGG + Intergenic
1119812191 14:77531475-77531497 GAGGAGGAGGAGGAGGGGGAGGG - Intronic
1119859104 14:77923882-77923904 CAGGGAGAGGGGAGGGGAGCAGG + Intronic
1119932012 14:78556907-78556929 GAGGAGGAGGGGAAGGGGGAGGG - Intronic
1120255019 14:82107459-82107481 AAGAGAGAGGGGAAGGGGGCTGG + Intergenic
1120306762 14:82780818-82780840 AAGGAGGAGGAGAAGGGAGAAGG - Intergenic
1120676945 14:87431586-87431608 CAGGAAGAAAAGAAGGGAGCTGG - Intergenic
1120940076 14:89939488-89939510 CAGCAACAGGAGCAGGAGGCGGG + Intronic
1121170975 14:91854403-91854425 GAGGAGGAGGAGGAGGGGGAGGG + Intronic
1121276426 14:92671189-92671211 CACGATGTGAAGAAGGGGGCAGG + Intronic
1121348864 14:93156953-93156975 GAGGAAGAGGGGAAGAGGGAGGG + Intergenic
1121490473 14:94355436-94355458 CAGGAAGGAGAGAGGTGGGCTGG + Intergenic
1121491616 14:94365148-94365170 CAGAAGGAGGAGACGGGGGCTGG + Intergenic
1121494364 14:94381725-94381747 CAGAAGGAGGAGACTGGGGCTGG + Intronic
1121535385 14:94687136-94687158 AGGGAACAGGAGAAGGGGGCTGG + Intergenic
1121592393 14:95125746-95125768 CAGGGAGGGGAGGAGGGGGAGGG + Intronic
1121616506 14:95317328-95317350 CTGGGAGTGGAGATGGGGGCAGG - Intronic
1121624613 14:95374973-95374995 AAGGAAGAGGGGAAGGAGGGAGG - Intergenic
1121624644 14:95375076-95375098 AAGGAAGAGGGGAAGGAGGGAGG - Intergenic
1121624673 14:95375190-95375212 AAGGAAGAGGGGAAGGAGGGAGG - Intergenic
1121624683 14:95375225-95375247 AAGGAAGAGGGGAAGGAGGGAGG - Intergenic
1121624699 14:95375280-95375302 AAGGAAGAGGGGAAGGAGGGAGG - Intergenic
1121624711 14:95375315-95375337 AAGGAAGAGGGGAAGGAGGGAGG - Intergenic
1121787506 14:96673547-96673569 CAGGCAGGGGAGAAGGGGAGGGG - Intergenic
1121961263 14:98262379-98262401 AAGCAAGAGGGGAAGGGGGGTGG + Intergenic
1121978124 14:98425094-98425116 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1122322229 14:100862004-100862026 GAGGAAGAAGAGAAGGTGGGAGG - Intergenic
1122322255 14:100862120-100862142 AAGGAAGAGGAGAAGAAGGCAGG - Intergenic
1122347066 14:101067341-101067363 GAGGAGGAGGACAAGGGGGAGGG - Intergenic
1122388108 14:101362610-101362632 CAGGTCGGGGAGAAGGTGGCCGG - Intergenic
1122451077 14:101808094-101808116 GAGGAGGAGGAGGAGGAGGCTGG + Intronic
1122508914 14:102250305-102250327 AGGGACGAGGAGATGGGGGCCGG - Intronic
1122658458 14:103278939-103278961 CAGGGAGAGCAGGAGGGCGCGGG + Intergenic
1122782668 14:104150200-104150222 GAGGAGGAGGAGGAGGGGGTGGG - Intronic
1122809370 14:104280451-104280473 CAGGGAGCGGAGCAGTGGGCTGG + Intergenic
1122812879 14:104297666-104297688 TAGGAGGAGGAGAGGGGGCCAGG + Intergenic
1122827023 14:104375331-104375353 CAGGACGGGGAGATGGGTGCGGG + Intergenic
1122827047 14:104375402-104375424 CAGGACGGGGAGATGGGTGCGGG + Intergenic
1122827071 14:104375473-104375495 CAGGACGGGGAGATGGGTGCGGG + Intergenic
1122876040 14:104665869-104665891 AAGGAAGAGGAGAAGGATGTGGG + Intergenic
1122979764 14:105186167-105186189 CCGGAGGAGCAGCAGGGGGCTGG + Intergenic
1124159646 15:27256502-27256524 CGGGGAGAAGAGAAGGGGGCTGG + Intronic
1124816784 15:33001703-33001725 GAGGAGGAGGAGGAGGGGGAAGG - Intronic
1124849832 15:33325710-33325732 AAGGAAGAGGGGGAGGGGGAAGG - Intronic
1124957876 15:34371263-34371285 AAGGAGGAGGAGAAGGAGGTGGG - Intergenic
1125049745 15:35283157-35283179 GAGGAAGAGGGGGAGGGGGAGGG - Intronic
1125353383 15:38790930-38790952 CAGGAAGAAGAGATGGGGTGGGG - Intergenic
1125387488 15:39153840-39153862 CAGAAAGTGGAGAAGAGAGCAGG + Intergenic
1125459864 15:39895285-39895307 GAGGAAGAGGGGGAGGGGGAGGG + Intronic
1125511877 15:40296565-40296587 GAGGAAGAGGAGGAGGAGTCAGG - Exonic
1126668013 15:51092838-51092860 AAGGAAGAGAAGCCGGGGGCAGG - Intronic
1126902534 15:53328757-53328779 GAGGAATAGGAAAAGGGAGCTGG - Intergenic
1127007663 15:54588630-54588652 GAGGAAGAGGGGAAGGGGGTAGG - Intronic
1127116985 15:55738764-55738786 CAGGAAGAAGAGAGGGAGGGAGG + Intronic
1127291797 15:57578055-57578077 GAGGAACAGGAGAAGGAGTCAGG - Intergenic
1127585821 15:60376865-60376887 CAGGAAGAAGAGCTGGGAGCAGG - Intronic
1127693203 15:61418126-61418148 CAAGAAGAGGAGAAGGAGAGAGG + Intergenic
1127705608 15:61544649-61544671 CAGGTAGAGGAGAAGCATGCAGG + Intergenic
1127775092 15:62258148-62258170 CAGGCAGAGGAGCAGCTGGCTGG + Intergenic
1127975050 15:63990934-63990956 CAGGCAGAGGAGTAGGGAGGGGG - Intronic
1128075069 15:64820837-64820859 CAGGAAGAGGAGCCTTGGGCAGG - Intronic
1128110368 15:65072214-65072236 CAGGAAGAGGAGGAGGAGATGGG - Intronic
1128226614 15:66006176-66006198 AAGGAAGAGGAGAGGCAGGCTGG + Intronic
1128535944 15:68490574-68490596 CAGGAAGAGGAGGGAGGAGCGGG - Intergenic
1128545677 15:68566092-68566114 CTGGATGAGGAGAAGGGGTTGGG + Intergenic
1128556948 15:68638215-68638237 CAGGAGGAGGAGGACAGGGCGGG - Intronic
1128557470 15:68641485-68641507 AGGGAAAAGGAGAAGGGGGAGGG + Intronic
1128560925 15:68667221-68667243 CAGGTAGAAGAGACCGGGGCTGG - Intronic
1128595945 15:68949392-68949414 TAGGAAGAGGGGAAAGGGGTAGG - Intronic
1128843893 15:70872412-70872434 GAGGGAGAGGAGGAGGGGGAGGG + Intronic
1129057822 15:72834435-72834457 TGAGAAGTGGAGAAGGGGGCAGG + Intergenic
1129171756 15:73812277-73812299 CAGGATCAGGGGATGGGGGCTGG - Intergenic
1129325669 15:74799050-74799072 CAGGAGGAGGTGCAGGGTGCGGG + Intronic
1129384069 15:75185911-75185933 GAGGAAGAGGGGGAGGGGGAGGG + Intergenic
1129675892 15:77632397-77632419 GAGGAAACGGAGGAGGGGGCTGG - Exonic
1129687038 15:77692354-77692376 CAGGAAGAGGACAAGGGGGCAGG + Intronic
1129763793 15:78148234-78148256 CAGGGAGAGGACAAGGGGAAAGG + Intronic
1129791190 15:78341544-78341566 CAGGAGGAGGAGGAGGTTGCAGG + Intronic
1130179735 15:81612928-81612950 CAGGAGGAGGAGGCGGGAGCAGG - Intergenic
1130226059 15:82059034-82059056 GAGGGGGAGGAGAAGGGGGAAGG - Intergenic
1130236403 15:82138690-82138712 CAGGAAGAGGACAAGTGGCCTGG - Exonic
1130473784 15:84246618-84246640 CAGGAACGGGAGGAGGGGGATGG - Intergenic
1130481199 15:84360682-84360704 CAGGAACGGGAGAAGGGGGATGG - Intergenic
1130517819 15:84639698-84639720 CTGGAGGATGAGAAGGTGGCAGG + Exonic
1130558482 15:84940534-84940556 GAGGAAGAGGATGAGGGGGAAGG - Intronic
1130718664 15:86363832-86363854 CAGGAAGAGCTGAGTGGGGCAGG - Intronic
1130744357 15:86635256-86635278 GAGGAGGAGGAGGAGGGGGAGGG - Intronic
1130927481 15:88396426-88396448 AAGGAAGGGGAGAAGGAGGAGGG - Intergenic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1131067221 15:89442226-89442248 CTGGAAAAGCAGAAAGGGGCGGG + Intergenic
1131120901 15:89822956-89822978 CAGGAAGAGCAGTTGGTGGCGGG + Intergenic
1131246630 15:90799881-90799903 GAGGAAGGGGAGAAGGAGGGGGG + Intronic
1131852133 15:96554692-96554714 GAGGAAGAGGAGGAGGAGGGAGG - Intergenic
1132390268 15:101433609-101433631 GAGGAACAAGAGAAGGGGGCGGG + Intronic
1132411188 15:101579292-101579314 CAAGAAGTGGGGAGGGGGGCAGG - Intergenic
1132414701 15:101612041-101612063 CAGCAAGATGAGAAGAGAGCAGG - Intergenic
1132483391 16:177455-177477 CAGGAAGGGGAGGAGGGGCTGGG - Exonic
1132490116 16:223916-223938 CGGGAGGAGGAGGAGGAGGCGGG - Intronic
1132646645 16:1002292-1002314 CAGGGAGCCCAGAAGGGGGCTGG - Intergenic
1132647310 16:1004997-1005019 GAGGGAGAAGAGAAGGGGGAGGG + Intergenic
1132651577 16:1023596-1023618 CCGGAAGAGGAGAAGGAGCCAGG - Intergenic
1133392378 16:5420877-5420899 GAGGGAGAGGAGGAGGGGGAGGG - Intergenic
1133412667 16:5581120-5581142 GATCCAGAGGAGAAGGGGGCAGG + Intergenic
1133460674 16:5983927-5983949 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1133741596 16:8655878-8655900 CAGGAAGAGGAGAGGGCTGAGGG + Intergenic
1133874744 16:9723201-9723223 GAGGAAGAGGAGGAGGAGACAGG + Intergenic
1134122817 16:11596757-11596779 AAGGGAGAGGAGGAGGGGGAGGG + Intronic
1134332618 16:13264996-13265018 CAGGAAGAGGAGAGGAGGGAAGG - Intergenic
1134523569 16:14928961-14928983 GAAGAAGAGGAGCAGGGGGAAGG - Intronic
1134615891 16:15650687-15650709 AAGGAAGAGGAGAAAGAGGATGG - Intronic
1134743176 16:16566498-16566520 GAGGAGGAGGAGAAGTGGGGGGG - Intergenic
1134924384 16:18145962-18145984 GAGGAGGAGGAGAAGTGGGGGGG + Intergenic
1135401149 16:22166873-22166895 GAGGAAGAAGAGATGAGGGCAGG - Intronic
1135543643 16:23351479-23351501 CAGGAACAGGAGGATGGGGAAGG - Intronic
1135612466 16:23880369-23880391 AAGGAGGGGGAGAAGGAGGCAGG - Intronic
1135727537 16:24868790-24868812 AAGGAGGAGGAGAAGGGTGAAGG - Intronic
1135879953 16:26245530-26245552 CATAGAGAGGAGAAGGAGGCTGG + Intergenic
1135934800 16:26770611-26770633 GAGGAAAAGGAGAAGAGGGAAGG + Intergenic
1135938744 16:26803019-26803041 AAGGAAGAAGAGAAGGAGGAAGG + Intergenic
1136042405 16:27590713-27590735 CAGGGAGAGGAGAAGGCCCCAGG - Intronic
1136081293 16:27854178-27854200 GAGGAAGAGGAGGAGGGGAAGGG + Intronic
1136124495 16:28167919-28167941 GGGGGAGAGGAGAATGGGGCGGG + Intronic
1136221500 16:28832246-28832268 CAGGAAGCTGAGATTGGGGCAGG - Exonic
1136362736 16:29791197-29791219 GAGGACGAGAAGAAGGGAGCCGG + Intronic
1136428319 16:30183651-30183673 GAGGAAGAGGAGGAAGGAGCTGG - Exonic
1136510757 16:30737112-30737134 CAAGAGGAGGAGGAGGGGCCGGG + Exonic
1136520895 16:30795093-30795115 CAGGGAGAAGTGAAGGGGGCTGG - Intergenic
1137557129 16:49477565-49477587 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1137557150 16:49477671-49477693 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1137557161 16:49477739-49477761 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1137581373 16:49635617-49635639 CAAGGAGAGGAGCAGGGAGCAGG + Intronic
1137783374 16:51116312-51116334 GGGAAAAAGGAGAAGGGGGCTGG - Intergenic
1137812933 16:51370364-51370386 CAGGCAGAGGAGAGGAGGCCAGG - Intergenic
1137859316 16:51830448-51830470 GAGGAAGAGGAGGAGGGGAGGGG - Intergenic
1137944564 16:52721439-52721461 GAGGAAGCTGAGAAGGAGGCAGG - Intergenic
1138126174 16:54440503-54440525 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1138307094 16:55988435-55988457 GAGGGAGAGGAGGAGGGGGAGGG - Intergenic
1138412324 16:56850440-56850462 CAGGGAGTGGAGAAGGGGCCTGG - Intergenic
1138417832 16:56881355-56881377 CAGGAAGCAGAGACGGGGCCGGG - Intronic
1138433174 16:56982360-56982382 CAGGGAGAGGAAAGGGGGCCAGG - Intronic
1138552187 16:57754039-57754061 CAGGAAGAGAAGATGAGGGACGG - Intronic
1138579411 16:57930558-57930580 AAGGAGGAGGGGAAGGGGGAGGG + Intronic
1139128582 16:64112798-64112820 AAGGAAGGCTAGAAGGGGGCTGG + Intergenic
1139389595 16:66598361-66598383 CTGAAAGAGGAGAAGTGGGTGGG - Intergenic
1139424947 16:66873756-66873778 GAGGGAGAGGAGGAGGGGGTAGG - Intergenic
1139424957 16:66873781-66873803 GAGGGAGAGGAGGAGGGGGTAGG - Intergenic
1139429510 16:66903721-66903743 CAGGGATAGGATGAGGGGGCTGG - Intergenic
1139521811 16:67487041-67487063 CAGGGAGAGGAGAAGATGGATGG + Intergenic
1139582189 16:67880292-67880314 CAGGATCAGCAGCAGGGGGCTGG - Intronic
1139582212 16:67880392-67880414 CAAGAAGAGGAGGTGGGGACAGG - Intronic
1139636942 16:68263865-68263887 CAGAGGGAGGGGAAGGGGGCAGG + Intergenic
1139687134 16:68612762-68612784 CAGGAGGAGGAGAAGAGGAGAGG + Intergenic
1139946282 16:70644735-70644757 GAGGAAGAGGAGGAGGGAGGAGG + Intronic
1140024277 16:71270258-71270280 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1140199620 16:72884629-72884651 CAGGAGGAGGAGAAGGAGAAAGG + Intronic
1140332244 16:74069540-74069562 CAGGCATAGGAGTATGGGGCAGG + Intergenic
1140685077 16:77425744-77425766 CAAAAAGAGGAGGAGTGGGCCGG + Intronic
1140766884 16:78168229-78168251 CAGGAAGAGGAAGAATGGGCAGG - Intronic
1140837820 16:78811665-78811687 TAAGAAGAGGACAAGGGGGCTGG - Intronic
1140871760 16:79113210-79113232 CAGGAAGTGGAGAAAGGGAAGGG + Intronic
1140903546 16:79391914-79391936 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1141078894 16:81033882-81033904 CAAGAAGAGGTGAAAGGGCCAGG - Intergenic
1141480107 16:84300672-84300694 TAAGAAAAGGAGAAGGGGCCAGG + Intronic
1141574710 16:84956398-84956420 CAGGAAGAGGAAAATTGGCCAGG + Intergenic
1141617305 16:85217259-85217281 CAGGAGGAGGGGACTGGGGCAGG + Intergenic
1141625728 16:85260043-85260065 GAGGCAGTGGAGGAGGGGGCTGG + Intergenic
1141635873 16:85313525-85313547 CAGGAAGGGGATCAGGGGGGTGG - Intergenic
1141703586 16:85653211-85653233 GAGGAGGAGGAGGAGGGGGAGGG - Intronic
1141703595 16:85653230-85653252 GAGGAGGAGGAGGAGGGGGGAGG - Intronic
1141703606 16:85653255-85653277 GAGGAGGAGGAGGAGGGGGTAGG - Intronic
1141703617 16:85653283-85653305 TAGGAGGAGGAGGAGGGGGTAGG - Intronic
1141703625 16:85653302-85653324 GAGGAGGAGGAGGAGGGGGTAGG - Intronic
1141775760 16:86121753-86121775 CAGGAGGAGGAGGAGGAGGGAGG - Intergenic
1141775767 16:86121772-86121794 TAGGAGGAGGTGAAGGAGGCAGG - Intergenic
1141855389 16:86677720-86677742 CGGGGAGAGGGGAGGGGGGCAGG - Intergenic
1142137811 16:88459698-88459720 GGGGAAGAGGGGAAGGGGGAAGG - Intronic
1142137840 16:88459767-88459789 GAGGAGGAGGGGAAGGGGGAGGG - Intronic
1142177422 16:88651507-88651529 CAGGGGGAGGAAATGGGGGCTGG - Intergenic
1142251414 16:88993677-88993699 GAGGAAGAGAAGAAGGGGAAAGG - Intergenic
1142251454 16:88993793-88993815 GAGGGAGAGAAGAAGGGGGAGGG - Intergenic
1142256312 16:89015383-89015405 CAGGAGGACGAGGAGGGGGATGG + Intergenic
1142296304 16:89224760-89224782 CAGGAAGAGGAGTTGAGGGCAGG + Intronic
1142410368 16:89912892-89912914 CAGGAAGAGATCATGGGGGCGGG + Intronic
1142482073 17:225253-225275 CAGCAAGAGGAGATGGGGATGGG + Intronic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142765262 17:2060846-2060868 CAGGAAGAGGAGCAGCAGGAAGG + Exonic
1142795430 17:2303570-2303592 GAGGAGGAGGAGAGGGAGGCGGG + Intronic
1142863423 17:2776843-2776865 GAGGAGGAGGAGGAGGGGGCTGG + Intergenic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1142889496 17:2933620-2933642 CAGGAAAGTGAGCAGGGGGCTGG - Intronic
1143035221 17:3991298-3991320 GAGAAAGAGGAGGAGGAGGCCGG - Intergenic
1143036294 17:4001156-4001178 GAGGAAGAGGAGGAAGAGGCAGG + Intergenic
1143122537 17:4617852-4617874 CAGTGAGGGGAGTAGGGGGCAGG - Intergenic
1143166082 17:4897859-4897881 CTAGAAGAGGAGAGGGGGGTCGG - Exonic
1143193777 17:5059798-5059820 GAGGAGGAGGAGGAGGGGGGAGG - Intergenic
1143236599 17:5407028-5407050 CAGCAAGAGGAGAAAGGGTAAGG + Intronic
1143381377 17:6498369-6498391 CAGGAAGAGGGGAAAGTGGTCGG + Intronic
1143391418 17:6561243-6561265 AAGGAAGAGGAGAAGGAGGAAGG - Intergenic
1143391543 17:6561692-6561714 GAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1143483412 17:7239494-7239516 GAGGAGGAGGAGGAGGGAGCAGG - Exonic
1143500744 17:7337101-7337123 CAGGAAGGGTAGAAGGAGGGTGG - Intronic
1143533732 17:7523139-7523161 CAGGAAGCAGATAAGGGGGTGGG - Intergenic
1143588335 17:7863730-7863752 CAGGAGTAGGAGTAGGGGGTTGG - Intronic
1143743015 17:8967386-8967408 GAAGAAGAGGAGAAGAGGGAAGG + Intergenic
1143753138 17:9045660-9045682 CCAGAAAAGGAGATGGGGGCAGG + Intronic
1143908216 17:10226727-10226749 CAGGAGGAGAGGAAGGGAGCAGG - Intergenic
1144032718 17:11336595-11336617 AAGGCAGATGAGGAGGGGGCAGG + Intronic
1144300104 17:13915504-13915526 GAGGGAGAGGAGAAGAGGCCTGG - Intergenic
1144343664 17:14331549-14331571 CTGGAAGAGGAGGAGGGCTCGGG + Intronic
1144580527 17:16456490-16456512 GAGGAAGAGGAGGAGGAAGCTGG + Intronic
1144746806 17:17621454-17621476 GAGGAGGAGGAGAAGGGGAAGGG + Intergenic
1144748488 17:17632059-17632081 GAGGAAGAGGAGAAGAGGGCTGG + Intergenic
1144764109 17:17723690-17723712 AGGGAGGAGGAGGAGGGGGCAGG - Intronic
1144968623 17:19093398-19093420 CAGGAAGAGGAGGAGGAGGGTGG + Intronic
1144979292 17:19158665-19158687 CAGGAAGAGGAGGAGGAGGGTGG - Exonic
1144988930 17:19219567-19219589 CAGGAAGAGGAGGAGGAGGGTGG + Intronic
1145907780 17:28525714-28525736 AAGCAAGAGGTGAGGGGGGCTGG - Intronic
1145909044 17:28532174-28532196 CAGGAAGATGAGATGCGGGGAGG - Intronic
1146127126 17:30238489-30238511 CAGGCAGGGGAGCAGGGCGCGGG - Intergenic
1146458570 17:33025796-33025818 GAGGATGAGAAGAAAGGGGCTGG - Intronic
1146658853 17:34651428-34651450 CTGGAGGAGCAGAACGGGGCTGG + Intergenic
1146704716 17:34992612-34992634 CAGGAGGTGGAGAAGGAGCCGGG + Exonic
1146908635 17:36633644-36633666 GAGGAAGGGGAGAAGGAGGAGGG + Intergenic
1146987346 17:37232891-37232913 GAGGAGGAGGACAAGGGGGATGG - Intronic
1147122734 17:38345230-38345252 GAAGAAAAGGAGAAGGGGCCAGG - Intergenic
1147193117 17:38748497-38748519 CGGGAAGAGGAGGGGGAGGCTGG + Intronic
1147319014 17:39634897-39634919 CAGGAAAAGCAGCAGGTGGCTGG + Intronic
1147353244 17:39868462-39868484 CAGGGCGAGGCGAAGGAGGCAGG - Intronic
1147383860 17:40070705-40070727 CAGGCAGAGGGGAAGGGGAGAGG + Intronic
1147443334 17:40460614-40460636 CAGGTAGAAGGGAAGGGGGCTGG - Intergenic
1147445413 17:40472291-40472313 CAGGCTGGGGAGAAGGGTGCTGG - Intergenic
1147465758 17:40609410-40609432 TAGGAAGAGGAGATCGGGGCCGG - Intergenic
1147602301 17:41754187-41754209 AAGGAAGAGGGGAGGTGGGCAGG + Intergenic
1148029800 17:44611703-44611725 CGGCTGGAGGAGAAGGGGGCTGG + Intergenic
1148052372 17:44775551-44775573 CGGGAGGAGGGGAAGGAGGCGGG - Intronic
1148115381 17:45172075-45172097 CTGGAAGCAGCGAAGGGGGCGGG - Intergenic
1148124177 17:45228472-45228494 CAGTAAGAGGAGAGCTGGGCTGG - Intronic
1148179647 17:45595043-45595065 GAGGAAGAGGAGAAAGGGGAAGG + Intergenic
1148269257 17:46250858-46250880 GAGGAAGAGGAGAAAGGGGAAGG - Intergenic
1148271460 17:46265401-46265423 TAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1148383901 17:47220935-47220957 CAGCCAGAGGAGAAGGGGGACGG - Intronic
1148392696 17:47284308-47284330 AAGGAAGAGGAAAAGGGACCAGG + Intronic
1148439642 17:47705121-47705143 GACGAAGAGGAGGAGGGGACTGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148736149 17:49865967-49865989 CAGGAGGGAGAGAAGGCGGCAGG + Intergenic
1148765716 17:50037262-50037284 CAGGAATAGGAGAAGGAGGTGGG + Intergenic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1148807599 17:50272172-50272194 CAGGAGGAGGGGGAGGAGGCTGG - Intronic
1148809373 17:50280329-50280351 CAGGAAGGTGAGGAGGTGGCAGG + Exonic
1148872795 17:50668600-50668622 GAGGAAGAAGAAAAGGGGTCAGG - Intronic
1149038389 17:52158932-52158954 GAGGAGGAGGAGGAGGAGGCTGG + Intronic
1149107105 17:52982651-52982673 AAGGAAGAGGAGGAGGGGGAGGG - Intergenic
1149114172 17:53071751-53071773 GAGGAAGAGGAGGAGGAGGAGGG + Intergenic
1149305681 17:55344542-55344564 CAGGCATAGTAGAAGGGGACAGG - Intergenic
1149430509 17:56593302-56593324 CAGGAGGAGGAGAAGGGGGGTGG + Intergenic
1149512695 17:57256448-57256470 GAGGAGGAGGAGATGGGGGTGGG + Intronic
1149621264 17:58047017-58047039 CGGGAAGGGGAGGAGGGAGCTGG - Intergenic
1149647388 17:58250049-58250071 CAGGAATAGGAGAGGGGCTCTGG - Intronic
1149696983 17:58623795-58623817 GAAGAAGAGGAGGAGGGGGAGGG + Intronic
1150139244 17:62714742-62714764 AAAAAAGAGGAGAAGGGGGAGGG - Intronic
1150478571 17:65492129-65492151 GAGGAAGAGGAGAGGGGCTCTGG + Intergenic
1150559756 17:66284361-66284383 CATGAAAAGTAAAAGGGGGCCGG + Intergenic
1150565662 17:66337172-66337194 GAGGAAGATAGGAAGGGGGCAGG + Intronic
1150643098 17:66962875-66962897 GAGGAAGAGGAGGAGGAGGAGGG + Intergenic
1150669764 17:67182453-67182475 CAGAAAGATGAGAAGTGAGCAGG + Intronic
1150809298 17:68344181-68344203 AAGGAAGAAGAGAAGGGAGATGG + Intronic
1150964019 17:69947219-69947241 CAGGAGGAGGAGGAGGGGGAGGG - Intergenic
1151200239 17:72462617-72462639 CACGAGGAGGAGAGGGAGGCTGG - Intergenic
1151351368 17:73534036-73534058 GAGGAGGAGGAGCAGGGAGCAGG - Intronic
1151439165 17:74117032-74117054 CAGGAAGAGGAGTGGGAGGCAGG + Intergenic
1151456019 17:74226256-74226278 GAGTGAGAAGAGAAGGGGGCTGG + Intronic
1151492997 17:74443705-74443727 AGGGAAGAGGTAAAGGGGGCAGG - Intronic
1151726456 17:75887723-75887745 TAGGAAGAAAAGAGGGGGGCCGG + Intronic
1151763329 17:76119752-76119774 CAGGAGGAGGAGGAGGGGCGAGG + Intronic
1151784606 17:76269318-76269340 CAGGAAGAGGACTGAGGGGCTGG + Intronic
1151868075 17:76818065-76818087 CAGGAGGAAGAGAGGGGGGAGGG + Intergenic
1152000435 17:77641917-77641939 CAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1152008496 17:77696846-77696868 AAGGAGGAGGAGAAGGGAGAGGG - Intergenic
1152013722 17:77735996-77736018 TGGGAAGAGGAGAAGGGGAATGG + Intergenic
1152214926 17:79026613-79026635 CAAGAGGAGGAGAGGGAGGCGGG - Intronic
1152267627 17:79305503-79305525 GAGGAGGCGGACAAGGGGGCAGG - Intronic
1152302032 17:79500640-79500662 CGGGAAAAGGAGAAGGGGGATGG - Intronic
1152375282 17:79915692-79915714 CAGGAGGAGGAGGTGGGGCCAGG + Intergenic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1152610829 17:81314359-81314381 CAGGAAGAGGGGAGGGGTGGCGG - Intronic
1152841550 17:82571998-82572020 GAGGAAGAGGAGTTGGGGGCCGG + Intronic
1152868508 17:82738049-82738071 CAGGCAGGGAAGAAGAGGGCTGG - Intronic
1153520912 18:5953174-5953196 CAGGAGAAGGGGAAGGGAGCTGG + Intergenic
1153575537 18:6516541-6516563 GAGGAAGAGGAGGAGGGAGGAGG + Intronic
1153680639 18:7497346-7497368 AAGGAAGAGGAGAAGGAGGAAGG + Intergenic
1153784563 18:8523175-8523197 CAGAGAGATGAGTAGGGGGCTGG - Intergenic
1153858577 18:9174804-9174826 CTGTAAGACAAGAAGGGGGCAGG - Intronic
1153987180 18:10362851-10362873 GAGGAAGAGAACAAGGGGGAAGG - Intergenic
1154345800 18:13542644-13542666 CAGGGAGAAGATAAGGAGGCGGG + Intronic
1154388623 18:13917626-13917648 CAGGAAGAAGAGACAGGGCCGGG + Intergenic
1154406055 18:14092235-14092257 CAGGACCAGGATAAGGGGTCAGG + Intronic
1155066623 18:22274010-22274032 GAGGAAGAGGAGGAGGGAGGAGG - Intergenic
1155066654 18:22274124-22274146 GAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1155086887 18:22467603-22467625 CAGGAGCAGCAGGAGGGGGCTGG + Intergenic
1155325309 18:24658511-24658533 GATGGAGAGGAGGAGGGGGCTGG + Intergenic
1155407997 18:25511648-25511670 GAGGAATAGGAGAAGGAGACAGG - Intergenic
1155654564 18:28177979-28178001 GAGGAATAGGAGAGGGGAGCGGG - Intergenic
1156300481 18:35832193-35832215 CAGGAAGAGGACACAGGAGCAGG + Intergenic
1156369994 18:36464725-36464747 CAGGAGGAGGCAAAGGGGGAGGG + Intronic
1156398196 18:36717945-36717967 GATGATGAGGAGAAGGGGGATGG + Exonic
1156436710 18:37138628-37138650 CAAGAAGAGGAGAATGGGGGCGG - Intronic
1156456396 18:37297046-37297068 CAGGGAGAGAAGAGGGGAGCAGG + Intronic
1156658265 18:39313457-39313479 CAGCAAGAGGAGAGGGGAGAAGG - Intergenic
1156791769 18:40984132-40984154 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1156892531 18:42206361-42206383 CAGGGTGGGGAGAAGGGGGAGGG - Intergenic
1157030489 18:43900966-43900988 AAGGAAGAGGAGGAAGGGGAGGG - Intergenic
1157197432 18:45630931-45630953 CAGGAGGATGGGAAAGGGGCAGG - Intronic
1157276069 18:46311896-46311918 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1157317119 18:46601522-46601544 CAGGAAGGGGAGGAGGGGGTGGG - Intronic
1157488680 18:48107420-48107442 GAGGAAGAGGAGAGGGAGGAGGG + Intronic
1157592702 18:48845130-48845152 AAGGAAGAGAAGAAGGGGGTTGG + Intronic
1157610036 18:48950339-48950361 GAGGACGAGGAGGAGGGCGCAGG - Exonic
1157884191 18:51350576-51350598 CAGGGAGAAGGGAAGGGGGAAGG - Intergenic
1158525502 18:58209343-58209365 GAGGAGGAGGAGGAGGGGGCAGG - Intronic
1158993938 18:62898007-62898029 GAGAAAGAGGAGAAGGGAGGAGG - Intronic
1159127329 18:64238777-64238799 CAGGAAATGGAGAAGGGGGTTGG - Intergenic
1159132293 18:64292672-64292694 CAGAGAGAGGAGAAGGGGTAAGG - Intergenic
1159135947 18:64337206-64337228 CCAGAAGAGGAGAACAGGGCAGG + Intergenic
1159593361 18:70358723-70358745 AAGGAAGTGGAGAAGGAGGCAGG + Intergenic
1160209033 18:76860688-76860710 CAGCAAGAGACGAAGGGAGCTGG - Intronic
1160231357 18:77052037-77052059 CTGGAAGAGGATGAGGAGGCTGG + Intronic
1160261193 18:77295763-77295785 CAGGCAAGGGAGAAGGTGGCTGG + Intergenic
1160499086 18:79393772-79393794 GAGGAAGAGGAAAGGGGCGCAGG + Intergenic
1160515645 18:79478063-79478085 CAGGCAGGGGGGCAGGGGGCAGG - Intronic
1160527125 18:79544564-79544586 CAGGAAAAGGAAAAGCGGGGCGG - Intergenic
1160804416 19:985735-985757 CAGGAAGAGGAGTCGGGAGCAGG - Intronic
1160819760 19:1052478-1052500 GAGGGAGAGGAGGAGGGGGAGGG + Intronic
1160819773 19:1052508-1052530 GAGGGGGAGGAGAAGGGGGGAGG + Intronic
1160840601 19:1145541-1145563 GTGAAAGAGAAGAAGGGGGCGGG + Intronic
1160900230 19:1424299-1424321 GAGGAAGAGGAGGAGGGACCAGG - Intronic
1160910854 19:1473243-1473265 GAGGAAGAGGTGATGGCGGCAGG - Exonic
1160920736 19:1519065-1519087 CAGAAAGATGGGAAGGGGCCAGG + Intergenic
1160949726 19:1659690-1659712 CCTGAAAAGGACAAGGGGGCTGG - Intergenic
1160965660 19:1746003-1746025 GAGGGAGAGGAGGAGGGGGAAGG + Intergenic
1160983431 19:1827035-1827057 GAGGAGGAGGAGGATGGGGCGGG + Exonic
1161007039 19:1941955-1941977 CAGGAGGAGGCGATGGGGCCAGG - Intronic
1161010172 19:1956063-1956085 CAGGAGGATGAGAAAGGGGCAGG - Intronic
1161258602 19:3323260-3323282 CAGGAAGAGGAGATTTGGGGAGG + Intergenic
1161395510 19:4043078-4043100 CAGGAAGAGCAGGAAGGGTCGGG + Intergenic
1161403794 19:4080919-4080941 GAGGAGGAGGAGAAGGGGGAGGG + Intergenic
1161404576 19:4084311-4084333 CAGGAAGAGGAGCGGAGGGAGGG + Intergenic
1161410110 19:4112386-4112408 CATGAGGAGGAGATGGGGGAGGG + Intronic
1161520278 19:4720004-4720026 GAGGAGGGGGCGAAGGGGGCAGG - Intronic
1161523671 19:4739851-4739873 CAAGAAGAGGACATGGGGCCGGG + Intergenic
1161610129 19:5237828-5237850 CAGGAAGGAGGGAAGGGGGCCGG + Intronic
1161693625 19:5752729-5752751 CATGGAAAGGAAAAGGGGGCCGG + Intronic
1161837037 19:6654802-6654824 CAGGAGGAGGAGGAGGAGGATGG - Intergenic
1161905847 19:7155944-7155966 AAGGAGGAGGAGAAGGAGCCAGG + Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162091628 19:8284048-8284070 AAGGCAGAGGGGAGGGGGGCGGG + Intronic
1162093865 19:8298896-8298918 AAGGCAGAGGGGAGGGGGGCGGG + Intronic
1162164949 19:8745985-8746007 AAGGAAGAGGGGAAGGGGAATGG - Intergenic
1162166020 19:8753449-8753471 AAGGAAGAGGGGAAGGGGAATGG - Intergenic
1162167086 19:8760905-8760927 AAGGAAGAGGGGAAGGGGAATGG - Intergenic
1162169094 19:8774661-8774683 AAGGAAGAGGGGAAGGGGAAGGG - Intergenic
1162169772 19:8779972-8779994 AAGGAAGAGGGGAAGGGGAAGGG - Intergenic
1162170838 19:8787431-8787453 AAGGAAGAGGGGAAGGGGAAAGG - Intergenic
1162176812 19:8836462-8836484 AAGGAGGAGGAGAGGGGGGGAGG - Intronic
1162315640 19:9936568-9936590 CCCGAAGAGGAGCTGGGGGCGGG - Intergenic
1162453555 19:10768930-10768952 AAGGCAGGGGAGGAGGGGGCTGG + Intronic
1162479711 19:10921227-10921249 CAGGAAGAGGAAAAGGTGAAAGG - Intronic
1162958402 19:14112479-14112501 CAGGGAGAGCCCAAGGGGGCTGG - Intronic
1162984119 19:14258384-14258406 CAGGAGGAGGAGCAGGGGGAAGG - Intergenic
1163029849 19:14537085-14537107 CCTGAGGAGGAGGAGGGGGCAGG + Intronic
1163303630 19:16463388-16463410 CAGGAAGAGTAGAAAGGGCTGGG - Intronic
1163451344 19:17379165-17379187 GAGGAACAGGAGCAGGGAGCCGG + Intergenic
1163463080 19:17450702-17450724 AAGGAAGAGGAGGAGGAGGAGGG - Intronic
1163505548 19:17703935-17703957 CAAGAGGAGGAGACGGAGGCAGG + Intergenic
1163516273 19:17765786-17765808 CAGCAGGAGGAGAAGGTGGAGGG + Intronic
1163703075 19:18796240-18796262 GAGTAAAAGGAGAATGGGGCTGG - Intergenic
1164039851 19:21484543-21484565 CAGAAACAGGAGGATGGGGCCGG - Intronic
1164188314 19:22892764-22892786 GAGGAAGAGGAGGAGGAGGGGGG - Intergenic
1164324425 19:24179474-24179496 GAGGAAGAGGAGCAGGAGGATGG + Intergenic
1164477404 19:28586046-28586068 CAGGAACAAGGGAAGGGTGCAGG - Intergenic
1164587441 19:29484866-29484888 CAGGGAAAAGAAAAGGGGGCTGG - Intergenic
1164643599 19:29843389-29843411 GAGGAAGAGGAGGAGGGGAGAGG + Intergenic
1164684055 19:30155677-30155699 CAGGACGGGGAGCAGGTGGCTGG - Intergenic
1164686869 19:30172448-30172470 CTGGAGCAGGAGAAGGGAGCTGG + Intergenic
1164718701 19:30415250-30415272 CAGGAGGAGGAGAAGGGGGAGGG - Intronic
1164768979 19:30793348-30793370 CAAGAAGCAGAGAAGGGGGTTGG + Intergenic
1164868667 19:31625731-31625753 GAGGAAGAGGAAAAGGAGGAGGG - Intergenic
1164868703 19:31625866-31625888 GAGGAAGAAGAAAAGGGGGATGG - Intergenic
1165094348 19:33402344-33402366 GAAGCAGAGGAGGAGGGGGCTGG + Intronic
1165132511 19:33641590-33641612 ATGGAAGGGAAGAAGGGGGCTGG + Intronic
1165205399 19:34180742-34180764 CAGCAAGAGGGGAATGGGGTGGG - Intronic
1165416034 19:35694092-35694114 AAGGAAGAGGAGGAGGGAGAAGG - Intergenic
1165470812 19:36003466-36003488 GAGGAAGAGGATAAGGAGGAAGG + Exonic
1165690924 19:37862550-37862572 GAGGAAGAGGAGGAGGGGTGGGG + Intergenic
1165707459 19:37986721-37986743 CAGGAAGAGGGGAAAGGGGAAGG - Intronic
1165741992 19:38210233-38210255 CGGGAGGAGGAGAAGGAGGACGG - Intergenic
1165887081 19:39085769-39085791 GGGGAAGAGGAGAAGAGGGATGG - Intronic
1165889185 19:39100459-39100481 TAGCAAGAGGAGATGGGGGTGGG + Intronic
1165951432 19:39475779-39475801 CAGGAAGAGGAGCAGGTGTGGGG + Intronic
1166135382 19:40773968-40773990 CAGGAAGTGGAGAAGTGGAGAGG - Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166143417 19:40818373-40818395 TAGGATGGGGAGAAGGGAGCTGG - Intronic
1166184135 19:41128405-41128427 TAGGATGGGGAGAAGGGAGCTGG + Intergenic
1166322701 19:42028483-42028505 CAGGAGGGGCAGAAGGTGGCTGG - Intronic
1166347964 19:42178047-42178069 GAGGAAAAGGAGAAGGGAGAGGG + Intronic
1166395053 19:42433530-42433552 CAGGAAAAGGATAAGGGGCAGGG + Intronic
1166536063 19:43575518-43575540 CAGGGAGAGTGGGAGGGGGCGGG + Exonic
1166604337 19:44127120-44127142 CAGCCAGAGGAGCAGGGGGTGGG - Intronic
1166652187 19:44582857-44582879 GAGGAAGAGGAGGAGGAGGACGG + Intergenic
1166700219 19:44878041-44878063 GAGGAGGAGGAGGAGGGGGGTGG - Intronic
1166852630 19:45767825-45767847 CTGGAAGAGGAGACGCGTGCGGG + Intronic
1166916850 19:46201349-46201371 CAGGAAGAGGAGACTGGAGTGGG - Intergenic
1166944087 19:46386519-46386541 CTGGAAGGGAAGAAGGAGGCCGG + Intronic
1167043383 19:47036069-47036091 GAGGAAGAGGAGACGGAGGGCGG - Exonic
1167056071 19:47112362-47112384 GAGGAAGAGGAGGAGGAGGAAGG - Intronic
1167071083 19:47222266-47222288 CAAGATGAGGAGAAAGGAGCAGG + Intronic
1167130489 19:47582171-47582193 GAGGAAGAGGAGGAGGGGGGAGG - Intergenic
1167295580 19:48646944-48646966 GAGGGAGAGGAGGAGGGGGAGGG + Intergenic
1167360183 19:49025916-49025938 CAGGAAGACCAGAGGGGGCCCGG + Intronic
1167360902 19:49029865-49029887 CAGGAAGACCAGAGGGGGCCCGG - Intronic
1167362750 19:49038932-49038954 CAGGAAGACCAGAGGGGGCCCGG + Intergenic
1167363385 19:49042256-49042278 CAGGAAGACCAGAGGGGGCCCGG - Intergenic
1167365108 19:49050671-49050693 CAGGAAGACCAGAGGGGGCCCGG + Intergenic
1167383987 19:49153511-49153533 GAGGAAGAGGAGGAGGAGGAGGG - Exonic
1167384393 19:49155546-49155568 GAGGAGGAGGAGCAGGAGGCAGG - Intergenic
1167471723 19:49679450-49679472 CATGAATAGCAGAAGGGAGCGGG - Intronic
1167645498 19:50703174-50703196 CAGGAAGAGGATGGGGGGGGTGG - Intronic
1167775643 19:51553004-51553026 AAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1167869391 19:52355255-52355277 CATGAATAGGTCAAGGGGGCAGG - Intronic
1167925937 19:52821113-52821135 CAGCAAGAGGAGGAGGGAGGTGG + Intronic
1167930123 19:52857099-52857121 CAGCAAGAGGAGGAGGGAGGTGG + Intronic
1168097991 19:54126345-54126367 CAGGAAGAGGGGATGAGGGCAGG - Intronic
1168315495 19:55483173-55483195 CAGCCAGTGGAGCAGGGGGCTGG - Exonic
1168416765 19:56174324-56174346 GAGGAGGAGGAGGAGTGGGCAGG - Intergenic
1168462430 19:56570321-56570343 CAGGAAGAGGTAGAGGTGGCAGG + Exonic
1168489661 19:56797644-56797666 GAGGAAGAGGAGGAGGAGGAGGG - Intronic
1168692522 19:58385694-58385716 CAGGGATGGGAGTAGGGGGCAGG + Intergenic
1202712713 1_KI270714v1_random:26629-26651 TAGGGAGAGGCGCAGGGGGCGGG - Intergenic
925410130 2:3635085-3635107 CAGGCAGGGGAGAGGGGGACAGG - Intronic
925496212 2:4452461-4452483 GAGGAGGAGGGGAAGGGGGAAGG - Intergenic
925497705 2:4470325-4470347 GAGGAAGAGGAGAAAGGAGGAGG + Intergenic
925587192 2:5475545-5475567 GAGGGAGAGGAGAAGGGGCCTGG + Intergenic
925647807 2:6054812-6054834 CAGGAACAGTGGCAGGGGGCAGG - Intergenic
925924220 2:8659055-8659077 CAGGAAGTGGGGAAGGGGTTTGG - Intergenic
926083331 2:10006247-10006269 CAGTAAGAGGTGAAGCGGGCTGG - Intergenic
926127175 2:10278748-10278770 GAGGAAGAGGAGAAGGGAATTGG + Intergenic
926145681 2:10395996-10396018 CAGGCAGAGAAGAGGGAGGCGGG + Intronic
926225050 2:10961372-10961394 AAGGAAGACCAGAAGGCGGCTGG + Intergenic
926516737 2:13855885-13855907 CAGAAAAGGGAGAAAGGGGCTGG + Intergenic
926570573 2:14525351-14525373 AAGGAAGAGGAGAAGGAGGGAGG + Intergenic
926685001 2:15691486-15691508 CAGGAAGATGACAAGGGGGACGG - Intronic
926726928 2:16005675-16005697 AAGAAAGAGGAGAAGGAGGGTGG - Intergenic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
927088022 2:19690085-19690107 AAGGAAGAGGGGAAGGGGAAGGG + Intergenic
927292923 2:21422282-21422304 CAGGGAGAGGAGAAGAAGGAGGG + Intergenic
927319262 2:21723404-21723426 GAGGAAGTGGAAGAGGGGGCAGG + Intergenic
927481830 2:23459977-23459999 CAGGTAGAGGAGAAGCTGGAAGG + Intronic
927486194 2:23489859-23489881 AAGGGAGAGGAGGAGGTGGCTGG + Intronic
927510437 2:23641008-23641030 GAGGAAGGGGAGTAGGGGGCAGG - Intronic
927557602 2:24047171-24047193 GAGGATGAGGAGAATGGGGCGGG - Intronic
927689560 2:25198170-25198192 GAGGAAGGGGAGAAGGGGAGCGG + Intergenic
927705634 2:25294873-25294895 AGGGAGGAGGAGGAGGGGGCTGG - Intronic
927756989 2:25716635-25716657 CAGGCAGAGGAGAAAGGGCCTGG - Intergenic
928076441 2:28269275-28269297 GATGGAGAGGAGAAGGGGGAAGG - Intronic
928151822 2:28837821-28837843 CAGGGAGAGGAGAAGCTGACTGG + Intronic
928281412 2:29949597-29949619 CAGGAAGAGGAAAAAGGGTGCGG + Intergenic
928325889 2:30319195-30319217 GAGGAGGAGGAGGAGGAGGCTGG + Intronic
928511876 2:32010422-32010444 CAGGAGGAGGAGATGGCAGCCGG + Exonic
928694557 2:33836214-33836236 CAGGAGTAGGGGAAGAGGGCAGG + Intergenic
929210320 2:39349720-39349742 AAAAAAGAGGAGAAGGGGGATGG + Intronic
929258512 2:39839394-39839416 CAGGAAGAGAATAGGGAGGCTGG - Intergenic
929394456 2:41506908-41506930 CAGGAAGAGGGGAAGGGCAGCGG + Intergenic
929441873 2:41971234-41971256 GAGGAAGACTGGAAGGGGGCCGG + Intergenic
929789543 2:45013099-45013121 AGGGAAAAAGAGAAGGGGGCGGG + Intergenic
929942392 2:46344517-46344539 AAGGAAGATGGGAAGAGGGCAGG - Intronic
930000088 2:46855545-46855567 CATGATGAAGAGGAGGGGGCAGG + Intronic
930873876 2:56192714-56192736 CTAGATGAGGAGAAGGGTGCAGG + Exonic
931007199 2:57865240-57865262 GAGGAAGAGGAGAATGGGGATGG + Intergenic
931090464 2:58880574-58880596 AGGAAAGAGGAGAAGGAGGCCGG + Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931144126 2:59498072-59498094 GAGGAAGAGGAGAAGGAGAAAGG - Intergenic
931517246 2:63057202-63057224 GAGGAAGAGCAGAAGGGGGACGG - Exonic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
931759325 2:65402587-65402609 GAGGGAAAGGAGAAGGGGGTAGG + Intronic
931902759 2:66807550-66807572 GAGGAGGAGGAGGAGGGGGAAGG + Intergenic
931996717 2:67845788-67845810 GAGGAAGAGGGGGTGGGGGCTGG + Intergenic
932088128 2:68780598-68780620 AAGGAAGGGGAGAAGGGGGAAGG - Intronic
932146000 2:69317810-69317832 AAGGAAGAGGAAAATGGGGTGGG + Intergenic
932327416 2:70872278-70872300 CAGGAAAAGGAGGGTGGGGCAGG + Intergenic
932337876 2:70941351-70941373 CAGAAAGAGGGGCAGTGGGCTGG - Exonic
932387669 2:71352178-71352200 TATAAAGAGGAGGAGGGGGCCGG + Intronic
932457519 2:71858769-71858791 CAGGGAGAGGGGAAGGGCCCAGG - Intergenic
932578225 2:72974422-72974444 CTGGATGAGGGGAAGGAGGCTGG - Intronic
932757262 2:74417432-74417454 CAGGCAGACGGTAAGGGGGCTGG + Exonic
932921847 2:75924956-75924978 GAGGAAGAGGAGAAAGAGGAAGG + Intergenic
932993121 2:76812770-76812792 GAGGGAGAGGAGGAGGGGGAGGG - Intronic
933196043 2:79391270-79391292 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
933242355 2:79936445-79936467 CAAGAGGAGGAAAAGGGGGTCGG - Intronic
933280374 2:80326470-80326492 CAGGGAGAGGCAAGGGGGGCAGG - Intronic
933328185 2:80864552-80864574 GAGGAAGAGGAGAAGAGGCAGGG - Intergenic
933441099 2:82315388-82315410 AAGGAAGAGGGGGAGGGGGAGGG - Intergenic
933810786 2:86031598-86031620 GAGGAAGAGGAGGAGAGGGAGGG - Exonic
933978589 2:87531714-87531736 GAGGAAGAGGAGAAGGAAGCAGG + Intergenic
934554231 2:95278913-95278935 CAGGAACAAGACAAGCGGGCAGG - Intronic
934574769 2:95392925-95392947 CAGGATGAGGAGGAAGGGGCTGG + Intergenic
934653221 2:96104131-96104153 AAGGAGGAGGAGGAGGGGGTAGG - Intergenic
934995374 2:98953096-98953118 AAAGAAGAGGAGAAGGAGGGCGG - Intergenic
935504672 2:103885405-103885427 AAGGAAGATGAGCAGGAGGCTGG + Intergenic
935531701 2:104240509-104240531 GAGGAAGAGGAGGAGGAGGAGGG + Intergenic
935750009 2:106223581-106223603 GAGAAAGAGGAGGAGGGGCCAGG + Intergenic
936029937 2:109062856-109062878 CGGGTGGAGGTGAAGGGGGCTGG + Intergenic
936231061 2:110699926-110699948 CAGGAAGTGGAAAATGGGGTGGG + Intergenic
936264689 2:110994505-110994527 CAGGAAGTGGGGAAAGGGGAGGG + Intronic
936267728 2:111023215-111023237 CAGGGAGATGAGAGGGGAGCGGG + Intronic
936272495 2:111059939-111059961 GAGGAAGAGGGGAAGGGGTAGGG + Intronic
936315243 2:111419088-111419110 GAGGAAGAGGAGAAGGAAGCAGG - Intergenic
936379407 2:111970745-111970767 GAGGAGGAGGAGAAGGGAGGAGG - Intronic
936379425 2:111970796-111970818 GAGGAGGAGGAGGAGGGGGGAGG - Intronic
936622391 2:114113822-114113844 CAGGAAGAGGAGAACCTTGCTGG + Intergenic
936847214 2:116851759-116851781 CAGAAAGAGGAAAATGGGGAAGG - Intergenic
936926541 2:117742713-117742735 CAGGAAGAGGAGGAGGAGCAAGG + Intergenic
937217704 2:120323308-120323330 GAGGAGGAGGAGGAGGGGGGAGG - Intergenic
937311096 2:120903953-120903975 CAGGAAGGGGAGATTGGGGAGGG + Intronic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937365424 2:121257505-121257527 CCTGAAGAGCAGCAGGGGGCAGG + Intronic
937463626 2:122110478-122110500 CAGGAAAAGGATAGGGGAGCTGG + Intergenic
937877695 2:126837656-126837678 CAGGCAGAGGAAAAGGTGCCAGG + Intergenic
937953746 2:127407999-127408021 CAGGGGGAAGAGGAGGGGGCGGG - Intergenic
938000935 2:127736283-127736305 GAGGAAGAGGAGACTGGGGAAGG + Intronic
938071989 2:128313604-128313626 AGGGAGGAGGAGAAGGGGCCTGG - Intronic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938137165 2:128769048-128769070 TAGGAAGAAGAGAAGGGGGAGGG + Intergenic
938190394 2:129274288-129274310 CAGGAAAAGGAGCAGAGGACAGG - Intergenic
938212946 2:129483848-129483870 CAGAAAGAGGAAAATGGGGGAGG - Intergenic
938235618 2:129704166-129704188 CCAGAAGAGGAGAAGGAGGGAGG - Intergenic
938292619 2:130158176-130158198 CAGGATGAGGAGCAGGTGGGAGG - Intronic
938443414 2:131355910-131355932 GAGGAGGAGGAGAAGGGGAAGGG - Intergenic
938463934 2:131514795-131514817 CAGGATGAGGAGCAGGTGGAAGG + Intergenic
938841096 2:135164641-135164663 CAGGAAGAGGACATGCTGGCAGG + Exonic
939069241 2:137518949-137518971 CTGGAAAAGGGGAAAGGGGCTGG + Intronic
939160098 2:138577271-138577293 CAGGAGGAGGAGGAGGAGGAGGG + Intergenic
939690443 2:145253926-145253948 CAGGAAGAGGAGGAGAGGTTGGG - Intergenic
939692756 2:145285986-145286008 CTGGAAGAGAAGAGGGAGGCTGG - Intergenic
939969642 2:148644889-148644911 GAGGAGGAGGAGGAGCGGGCCGG + Intronic
939986460 2:148833994-148834016 AAGAAAGAGGGGAAGGGGGAAGG - Intergenic
939997830 2:148936951-148936973 GAGGAGGAGGAAAAGGGAGCAGG - Intronic
940011537 2:149060025-149060047 AAGGAGGAGGAGGAGGGGGCAGG + Intronic
940212630 2:151271252-151271274 AAGGAAGAGGAAAAGGGAGCAGG + Intronic
940216135 2:151305402-151305424 GAGGAGGAGGGGAAGGGGGAGGG + Intergenic
940219383 2:151335847-151335869 CAGGGAAAGGAGAAGGGCGGTGG - Intergenic
941038220 2:160590576-160590598 GAGGGAGAGGAGAAGGGGAAGGG - Intergenic
941072062 2:160966678-160966700 CAGGGAGAGGAGCAGGGGGAAGG + Intergenic
941256935 2:163243735-163243757 CAGGAGGAAGAGAGGGAGGCAGG + Intergenic
941424759 2:165328516-165328538 CAGGAAGTAGAGAAGGAGACAGG + Intronic
941684768 2:168437120-168437142 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
941800709 2:169656512-169656534 GAGGAGGAGGAGAAGGAGACAGG + Intronic
941809240 2:169739003-169739025 GAGGGAGAGGAGATGGGGGAGGG - Intronic
942199450 2:173556365-173556387 CAGGAGGAGGAGGAAGGGGGAGG - Intergenic
942251837 2:174053882-174053904 CTGGAAGAGAAGTAGGGGGCGGG + Intergenic
942312714 2:174670291-174670313 CAGGGAGAGGAAAAGGGAGGAGG - Intronic
942965859 2:181891913-181891935 GAGGAGGAGGAGGAGGGGACAGG - Exonic
943174804 2:184457097-184457119 CAGGAAAAGGAGTAGGGATCAGG + Intergenic
943540083 2:189202763-189202785 AAGGATGAGGATAAGAGGGCAGG + Intergenic
944890673 2:204114377-204114399 CAGGAAGGGGAGAAAGCTGCAGG - Intergenic
944932720 2:204536226-204536248 GAGAAAGAGGGGTAGGGGGCAGG + Intergenic
945188793 2:207166077-207166099 CAGGAGGAGGAGAAAAGGGAGGG - Intronic
945236999 2:207640254-207640276 CAGGAACAAGAGAGGGGGGCAGG - Intergenic
945395244 2:209307853-209307875 CTGGGAGTGCAGAAGGGGGCAGG + Intergenic
946148554 2:217748927-217748949 CAGGAAGAGGAGGAGGCAGCAGG - Intronic
946149366 2:217753769-217753791 CAGTAACTGGAGAAGGGGGCAGG + Intronic
946162005 2:217841164-217841186 CTGGAAAGGGAGAAGGGGGAAGG + Intronic
946189923 2:218002755-218002777 CAGCAAAAGGATAAGGTGGCAGG + Intronic
946385992 2:219384864-219384886 CAGAGATTGGAGAAGGGGGCTGG + Intronic
946427298 2:219606164-219606186 CAGGAAGGGGAGAATGAGGAGGG - Intronic
946483462 2:220078454-220078476 GAGGAAGAAGAGAAGGAGCCTGG + Intergenic
946519089 2:220446627-220446649 AAGGGAGGGGGGAAGGGGGCAGG - Intergenic
946519117 2:220446687-220446709 GAGGGAGGGGAGAAGGGGGGAGG - Intergenic
946679590 2:222199366-222199388 CAGGAAGAAGGGAAGGAGGGAGG + Intergenic
946716501 2:222559177-222559199 CAGCGAGAGGAGCAGGGGCCGGG - Exonic
946809784 2:223511381-223511403 AAGGAAGAAGAGATGAGGGCTGG + Intergenic
946857670 2:223968899-223968921 GAGGAGGAGGAAAAGGGGGATGG - Intergenic
947200733 2:227612565-227612587 CAAGAAGAGGCAAAGGCGGCTGG - Intronic
947543177 2:230992274-230992296 CAGGAAGCTGTGATGGGGGCAGG - Intergenic
947608601 2:231507547-231507569 GAGGAAGAGGAGGAGGGGGAAGG - Intergenic
947628118 2:231633998-231634020 CAGGACGAGGAGAACGGGAGTGG + Intergenic
947843148 2:233221759-233221781 CAGGCAGAGGAGATGGGAGAAGG - Intronic
948021348 2:234736312-234736334 CTGGAGTAGGGGAAGGGGGCAGG - Intergenic
948029057 2:234801421-234801443 CAGTTTGAGGAGAAGGGAGCAGG - Intergenic
948049102 2:234966080-234966102 GAGAAAGAGGAGAAAGAGGCTGG + Intronic
948078989 2:235190079-235190101 CCGAAGGAGGAGATGGGGGCAGG - Intergenic
948208496 2:236175746-236175768 CCAGAAGAGGAGCTGGGGGCTGG + Intergenic
948229742 2:236341363-236341385 TAGGAGGAGGAGAAAGGAGCGGG + Intronic
948237744 2:236403119-236403141 AAGGAAGAGGAGGAGGGGGAGGG + Intronic
948468075 2:238161680-238161702 CAAGAAGAGGAGCAGGGGCAAGG + Exonic
948523402 2:238556446-238556468 GAGAGAGAGTAGAAGGGGGCAGG + Intergenic
948538971 2:238672223-238672245 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
948593688 2:239066511-239066533 CTGGAAGAGGTGCAGGGGGCAGG - Intronic
948600712 2:239106163-239106185 CAGGCAGAGGAGCCGAGGGCGGG + Intronic
948610285 2:239162339-239162361 CAGGATGAGGAGCCAGGGGCAGG - Intronic
948856859 2:240734277-240734299 CAGGGAGAGGGGAGCGGGGCTGG + Intronic
948857183 2:240735619-240735641 CAGGAATTGGAGTAGGGGGTGGG - Intronic
948892896 2:240915843-240915865 CAGGAGGAAGAGATAGGGGCCGG + Intergenic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
949000421 2:241610091-241610113 GAGGAAGAGGCCAAGGGGCCTGG + Intronic
949003001 2:241628129-241628151 CAGAATGGAGAGAAGGGGGCTGG - Intronic
1168898677 20:1341737-1341759 GAGCAAGAGGAGAAGGGGATGGG - Intronic
1168975451 20:1962377-1962399 GATGAAGAGGTGAAAGGGGCAGG + Intergenic
1168995486 20:2129807-2129829 CAAGCAGAGGAGGAGGGAGCCGG + Intronic
1169043739 20:2518952-2518974 CAGGAAAGAGAGAGGGGGGCAGG - Intronic
1169074121 20:2751034-2751056 AAGGAGGAGGAGAAGGGCGTGGG + Intronic
1169130988 20:3166364-3166386 CAGGAAACGCAGGAGGGGGCTGG + Intronic
1169178644 20:3542606-3542628 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1169211677 20:3769165-3769187 CAGAAAGAGGCGGAGGAGGCAGG - Intergenic
1169282405 20:4278748-4278770 GAGGAAGAAGAGGAGGGGGAAGG - Intergenic
1169506463 20:6216541-6216563 GAGGAAGAGAAGAGGGAGGCAGG + Intergenic
1169757390 20:9057919-9057941 GAGGAAAAGGAGAAGGGCGTGGG + Intergenic
1169765574 20:9144661-9144683 AAGGAGGAGGAGGAGGGGGAAGG + Intronic
1169810690 20:9606227-9606249 CAGGAGGAAGAGAGGGCGGCAGG - Intronic
1169908083 20:10623786-10623808 CAGGCTGAGGAGCAGGGGGATGG - Exonic
1170158485 20:13289623-13289645 GAGGAAGAAGAGAAGGGGAAGGG + Intronic
1170802374 20:19601170-19601192 CAGGTAGAGGAGAAGGCGAATGG - Intronic
1170862170 20:20116748-20116770 CAGGAAGAGTAGAGGGGTGGGGG - Intronic
1170938240 20:20827860-20827882 AAGGAAGGGGAGGAGGGGGAAGG + Intergenic
1170957177 20:20991866-20991888 CAGGAAGAGGAGAGTGGCACAGG - Intergenic
1171074693 20:22110642-22110664 GAGGAAGAGGAGGAGGGAGAGGG - Intergenic
1171193313 20:23177732-23177754 AAGGAAGAGGAGAGGGGAGTTGG - Intergenic
1171255943 20:23689109-23689131 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171272356 20:23826800-23826822 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171282622 20:23913892-23913914 CAGGAATTGGTGTAGGGGGCGGG + Intergenic
1171371621 20:24665972-24665994 CTGCAAGACGAGAATGGGGCTGG + Exonic
1171433934 20:25104651-25104673 CAGCAAGAGGAACCGGGGGCTGG + Intergenic
1172031551 20:31985433-31985455 CAGGGAGAGGAGGAGCAGGCAGG + Intronic
1172147120 20:32764481-32764503 CAGGAAAAGGAGAGGCTGGCAGG - Intronic
1172160817 20:32866752-32866774 GAGGAAGGGAAGAAGGGGGAGGG - Intronic
1172228802 20:33323298-33323320 GAGGAAGTGGAGAGGGTGGCTGG - Intergenic
1172274121 20:33670577-33670599 TAGGATGAGGAAGAGGGGGCAGG - Intronic
1172392367 20:34574595-34574617 CAGGCAGAGGAGAAGGGGGCCGG - Intronic
1172692040 20:36796746-36796768 CAGGAAGAGGGCAAAGGGGCGGG + Intronic
1172892833 20:38279050-38279072 CAGGCAGAGGGGAAGTGGTCAGG + Intronic
1172928628 20:38564866-38564888 GAGGAAGAGGAGGAGGAGGGAGG - Intronic
1172954067 20:38742960-38742982 GAAGAAGAGGAAAAGTGGGCTGG + Intergenic
1172957270 20:38769831-38769853 GAGGAAGAGGAGTGGGGAGCAGG + Intronic
1173106974 20:40146100-40146122 CAGGAGGAGGAGGAGGAGGGAGG - Intergenic
1173160056 20:40645873-40645895 GAGGAAGAGGAGAAGATGGAAGG + Intergenic
1173342499 20:42165123-42165145 AAGGAAGAGGAGGAGAGAGCAGG - Intronic
1173465212 20:43275514-43275536 CAGGGAGTGGAGTAGGGGGTGGG - Intergenic
1173547996 20:43914340-43914362 CAGTGAGACGAGGAGGGGGCGGG + Intergenic
1173648754 20:44650167-44650189 CAGTAAGACGTGAAGGAGGCAGG + Intronic
1173754332 20:45501837-45501859 CATGAAGAGTAGAAGCAGGCAGG + Intergenic
1173929606 20:46807656-46807678 CAGGGGGAGGAGAAGGGAACAGG + Intergenic
1173990977 20:47303198-47303220 CAGGAAGGGGAAGAGAGGGCGGG + Intronic
1174049739 20:47759288-47759310 GAGGTCGAGGAGAAGTGGGCAGG - Intronic
1174137544 20:48391008-48391030 AAGGAAGAGAAGGAGGGGGTAGG + Intergenic
1174137571 20:48391084-48391106 AAGGAAGGGAAGGAGGGGGCAGG + Intergenic
1174150375 20:48482158-48482180 GAGGAGGAGGAGCAGGGGGAAGG + Intergenic
1174197842 20:48786047-48786069 CAGCAGGAAGAGAATGGGGCTGG + Intronic
1174287046 20:49481182-49481204 GAGGAGGAGGAGGAGGAGGCAGG - Intronic
1174287526 20:49483465-49483487 GAGAAGGAGGAGAAGGGGGCGGG - Intergenic
1174571325 20:51503745-51503767 CAGGGAGAGGAGGCTGGGGCAGG + Intronic
1174655375 20:52167535-52167557 GGGGAAGAGGAGAAGGAGGGAGG - Intronic
1174738003 20:52984051-52984073 CAGGAAGAAGGGAAGCTGGCTGG + Intronic
1175031339 20:55957559-55957581 GAGAAAGAGGAGAAGGGTGGGGG - Intergenic
1175120092 20:56710616-56710638 GAGGTAGAGGGGAAGGGGGAAGG - Intergenic
1175120157 20:56710814-56710836 GAGGAAGAGGGGAAGGAGGAGGG - Intergenic
1175120182 20:56710889-56710911 GAGGAAGAGGGGAAGGAGGAGGG - Intergenic
1175128995 20:56775112-56775134 CAGGAGAAAGAGAAGGGGGAGGG - Intergenic
1175140451 20:56857025-56857047 AAGGGAAAGGAGAAGGGAGCGGG + Intergenic
1175174559 20:57103119-57103141 CAGGAATAGAGGCAGGGGGCTGG - Intergenic
1175225542 20:57441886-57441908 CAGGGGGAGGGGCAGGGGGCAGG + Intergenic
1175298833 20:57928584-57928606 AAGGAGGAGGAGAAGGGTGGGGG - Intergenic
1175710049 20:61212437-61212459 CAGCAAGAGATGAAGAGGGCTGG - Intergenic
1175891585 20:62318245-62318267 GAGGAAGAGGAGGAGGGGGAGGG + Intronic
1175959238 20:62626635-62626657 CTGGAAGAGCAGGAGGGGGAGGG - Intergenic
1175988724 20:62777077-62777099 CAGGAGGAGGAGATGGGAACAGG + Intergenic
1176072960 20:63236289-63236311 GAGGAAGAGGAGGAGGGCGCCGG + Exonic
1176090806 20:63317866-63317888 GAGGAAGAGGAGAGGGGGGCGGG - Intronic
1176094849 20:63335902-63335924 CAGGAAGAAGAGGAGGGAGAAGG + Intergenic
1176184440 20:63770724-63770746 CATGACGAGGAGAACTGGGCAGG + Intronic
1176236153 20:64054458-64054480 CTGGCAGGGGAGAAGGAGGCTGG - Intronic
1176362066 21:6006183-6006205 AAGGAGGAGGAGGAGGGGGGGGG + Intergenic
1176740301 21:10595521-10595543 CAGGAACAAGAGAAGAGGGATGG + Intronic
1176968155 21:15235143-15235165 CAGGCAAAAGAGAAGAGGGCAGG - Intergenic
1177177128 21:17712299-17712321 GAGGAGGAGGAGAAGGGAGAAGG - Intergenic
1177507230 21:22034750-22034772 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1177517796 21:22177408-22177430 CGGGAGGAAGAGAAAGGGGCAGG - Intergenic
1177529568 21:22341899-22341921 GAGGAAGAGAAGAGGGGAGCAGG + Intergenic
1177782854 21:25639383-25639405 CAGGGCGAGGAGCTGGGGGCGGG - Exonic
1178074928 21:29006094-29006116 CAGGTAAGGGAGAAGGGGGTTGG + Exonic
1178110682 21:29367104-29367126 CAGAAAGAGGAGGAGGTGCCAGG - Intronic
1178287751 21:31339355-31339377 CAGGAGGAGGAAGAGGAGGCTGG - Exonic
1178379159 21:32093659-32093681 GGGGAAGAGGACATGGGGGCAGG - Intergenic
1178397119 21:32252417-32252439 AAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1178513939 21:33230330-33230352 CAGGAGGAGGAGGAGGAGTCGGG - Intronic
1178624181 21:34201931-34201953 CAGGGAGGGGAGTAGAGGGCGGG - Intergenic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1178787587 21:35667822-35667844 CAGGAAGAGGTGATGGGTGGTGG + Intronic
1178839952 21:36130292-36130314 CAGGAGGAGGAGATGGCAGCCGG - Intergenic
1179025106 21:37673371-37673393 CTGGAAGAGGGGGAGGGGACAGG - Intronic
1179073761 21:38098700-38098722 CAGGAAAGGGAGTAGGAGGCAGG - Intronic
1179084815 21:38207422-38207444 AAGGGAGAGGAGAAGGGAGAAGG - Intronic
1179133681 21:38661028-38661050 GAGGAAGAGGAGGAGGGAGGCGG + Intronic
1179434277 21:41349673-41349695 GAGGTAGAGGAGAAGGGGGCTGG + Intronic
1179444276 21:41420484-41420506 CAGGGGGCGGGGAAGGGGGCAGG - Intronic
1179505669 21:41838663-41838685 TAGGCAGAGAAGATGGGGGCGGG - Intronic
1179521215 21:41946474-41946496 CAGGAGGGGGAGAAAGAGGCGGG - Intronic
1179586192 21:42375481-42375503 CAGGCAGAGGAGCTGGGGCCCGG - Intronic
1179720400 21:43313251-43313273 CAGGAGGAGGTGCTGGGGGCGGG - Intergenic
1179761452 21:43532362-43532384 AAGGAGGAGGAGGAGGGGGGGGG - Intronic
1179799320 21:43803549-43803571 GAGGAAGAGGAGCAGGAGGAGGG + Exonic
1180031379 21:45210818-45210840 CAGGAAAAGGAGGAGCTGGCAGG + Intronic
1180048953 21:45322751-45322773 GAGGAAGAGGAGGGCGGGGCTGG - Intergenic
1180064259 21:45404983-45405005 CGGGGAGGGGAGAGGGGGGCGGG - Intergenic
1180228858 21:46414418-46414440 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
1180605364 22:17055028-17055050 GAGGAAGAGGAGAAGCATGCAGG + Intergenic
1180874890 22:19170614-19170636 CAGGAACAGGAGAAGGAGTCAGG - Intergenic
1181038965 22:20183000-20183022 CAGGAGGAGGAGCAGGGCTCAGG - Intergenic
1181473836 22:23156792-23156814 CCCGAAGAGGCGAAGGGTGCAGG - Intronic
1181577171 22:23802429-23802451 AAGGAAAAGGAGGAGGGGGTAGG - Intronic
1181602185 22:23959215-23959237 CAGGAAAAGGACAAGAGGTCAGG - Intronic
1181606324 22:23982092-23982114 CAGGAAAAGGACAAGAGGTCAGG + Intronic
1181752313 22:24997340-24997362 CAGGAAAAAGAGAAGGCGACTGG + Intronic
1181776221 22:25161751-25161773 CAGGAAAAGGAGAAGGGGAGGGG - Intronic
1181832322 22:25570716-25570738 CAGGAGAAGCAGAGGGGGGCCGG - Intronic
1181886085 22:26023508-26023530 GAGGAAGAGGAGGAGGGAGGAGG - Intronic
1181935275 22:26433809-26433831 CACGAAGAGGACCAGGAGGCAGG - Exonic
1181985095 22:26794981-26795003 CAGGAACAGGAGCAAGGTGCAGG - Intergenic
1182106755 22:27695205-27695227 CAGGAAGAGGAGAAAGAGGCGGG + Intergenic
1182268084 22:29135049-29135071 CAGGGAGAGAAGAAGGGTGTGGG - Intronic
1182477301 22:30583165-30583187 AAGGAGGAGGAGAGGAGGGCTGG + Intronic
1182696615 22:32203019-32203041 CAAGAACAGGAGGAGGTGGCCGG + Exonic
1182724864 22:32436389-32436411 GAGGAAGAGGAGGAGGAGGAGGG + Intronic
1182744266 22:32593605-32593627 GAGGAGGAGGAGAAGGAGGGAGG + Intronic
1183021723 22:35032837-35032859 AAGAAAGTGGAGAAGGGGGAGGG + Intergenic
1183100743 22:35582557-35582579 TGGGAAGAGGAGAAGTGGGTGGG + Intergenic
1183248438 22:36711435-36711457 CAGGAAGAGGAGGAAGGGAAGGG + Intergenic
1183325096 22:37187123-37187145 TAGCAGCAGGAGAAGGGGGCTGG + Intronic
1183419772 22:37704727-37704749 CAGGAAGAGGAGAGGAAGGAAGG + Intronic
1183454134 22:37912289-37912311 CAGGAAGAGGAGGAGGCGTTAGG - Intronic
1183467585 22:37987421-37987443 CAGGAAGAGGACTTGGGAGCTGG - Intronic
1183546659 22:38457760-38457782 CAGGGAGAGGAGGAAGGGGCAGG + Intergenic
1183601748 22:38844041-38844063 CGGGAGGAGGAGAAGACGGCAGG + Intergenic
1183623009 22:38985789-38985811 CTGGGAGAGGAGCAGGGGGCAGG - Intronic
1183633014 22:39044918-39044940 CTGGGAGAGGAGCAGGGGGCAGG - Intronic
1183720158 22:39557844-39557866 CGGGAGGAGGAGGAGGCGGCGGG - Intergenic
1183726784 22:39594360-39594382 CAGGAAGAGGGGAAAGGCGAGGG + Intronic
1184189553 22:42885743-42885765 CCAGGAGAGGAGAAAGGGGCAGG - Intronic
1184310376 22:43637376-43637398 CGGGAAGAGGACCAGGGAGCTGG + Intronic
1184350891 22:43943516-43943538 CAGGCAGAAGGGGAGGGGGCTGG - Intronic
1184362416 22:44026327-44026349 CAGGAGGAGGAGCAGGACGCCGG + Intronic
1184449795 22:44576083-44576105 GAGGAAGAGGAGGAGGGAGGAGG + Intergenic
1184525264 22:45019052-45019074 GAGGAAGAGGAGGAGGAGGGAGG + Intergenic
1184600224 22:45539095-45539117 GGGGAAGAGGAGAAGGGAGGGGG - Intronic
1184695629 22:46137405-46137427 CAGGAGGAGGAGTCGGGGGAGGG - Intergenic
1184709407 22:46239671-46239693 CAGGAAGAGGTGAAGAGGAGAGG - Exonic
1184881527 22:47307473-47307495 CAGCAAGAAGGGAAGGAGGCTGG - Intergenic
1184939189 22:47748511-47748533 CTGGAGGAGGAGGAGGGTGCAGG + Intergenic
1184950298 22:47837219-47837241 CAGGAAGAGAAGAAGGCAGGAGG - Intergenic
1185055297 22:48575955-48575977 GAGGAAGAGGAGGAGGAGGAAGG + Intronic
1185057986 22:48591263-48591285 CAGGAAGAGGAGAAGCTTCCCGG + Intronic
1185089360 22:48757179-48757201 AAGGAGGAGGAGAAGGGAGGAGG + Intronic
1185089372 22:48757218-48757240 AAGGAGGAGGAGAAGGGAGGAGG + Intronic
1185097158 22:48816554-48816576 GAGGAAGAGGAGGAGGAGGAGGG - Intronic
1185346839 22:50314096-50314118 CTGGAAGAGGATCAGGGGTCTGG + Intronic
1185388152 22:50545962-50545984 TACGAGGAGGAGAAGAGGGCAGG + Intergenic
949094318 3:67739-67761 AAGGAAGAGGAGGAGGAGGAAGG + Intergenic
949113780 3:295032-295054 AAGGAAGAGGAGAAGGAGAAAGG - Intronic
949127947 3:469091-469113 GAGGAAAAGGAGAAGGGGGACGG - Intergenic
949447008 3:4145844-4145866 AAGGAAGAGATGAATGGGGCTGG - Intronic
949551559 3:5116203-5116225 GAGGGAGAGGAGGAGGGGGAGGG - Intergenic
949575186 3:5331887-5331909 AAAGAGGAGAAGAAGGGGGCAGG - Intergenic
949644992 3:6083326-6083348 CAGGCAGAGGAGGAGGGGTGTGG - Intergenic
949667632 3:6358703-6358725 CAGGAAGAGAAGAAGGAGAAAGG - Intergenic
949833610 3:8244109-8244131 CAGGAAAAGGGGAAGGGAGAAGG + Intergenic
950042569 3:9929777-9929799 CAGAAAGACCAGAATGGGGCAGG - Intronic
950151976 3:10694831-10694853 GAGGGAGGGGGGAAGGGGGCAGG - Intronic
950188874 3:10962497-10962519 AAGGGAGAGGAGAAGAGGGTAGG + Intergenic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950404584 3:12796802-12796824 CGGGAAGGAGAGAAGGGGGCCGG - Intronic
950665503 3:14492612-14492634 GAGGAAGAGGAGAAAGAGGGAGG - Exonic
950670328 3:14521902-14521924 GAGGAAGGGGAGGAGGGGACGGG + Intronic
950704925 3:14773634-14773656 GAGGAAGATGAGAATGGTGCAGG + Intergenic
950708055 3:14795872-14795894 CATGAAGATGAGAAGTGGGGTGG - Intergenic
950796729 3:15516318-15516340 CAGGCAGGGGAGCACGGGGCTGG + Intronic
950841660 3:15973949-15973971 GAGGAAGAGGAGAAGGAGGAAGG - Intergenic
950917864 3:16664034-16664056 GACCAAGAGGAGAAGGGGGCGGG + Intronic
950924645 3:16728413-16728435 CAGGAGGGTGAAAAGGGGGCAGG + Intergenic
951080335 3:18444869-18444891 AAGGAAGAGAAGGAGGGGGAGGG + Intronic
951639341 3:24817788-24817810 CAAGAAGAGGAGAAAAGGGGTGG - Intergenic
951964986 3:28372024-28372046 CAGGAAGAGAAGGAGGAGGAGGG - Intronic
952042948 3:29281847-29281869 CAGGAAGAAGTGATGGGGGTGGG - Intronic
952221539 3:31328426-31328448 CAGGAGAAAGGGAAGGGGGCAGG + Intergenic
953350280 3:42210102-42210124 GAGGAGGAGGAGGAGGGGTCTGG + Intronic
953596317 3:44318128-44318150 CAGGAAGGGGAGAAGGGCTGGGG + Intronic
953839398 3:46377014-46377036 AAGGAAGGGCAGGAGGGGGCTGG + Intergenic
953860555 3:46540768-46540790 CAGGGCCACGAGAAGGGGGCAGG - Intronic
953930232 3:47002308-47002330 CAGGAAGAGGAGTGGGGGCTGGG + Intronic
954108067 3:48419813-48419835 CAGGAACAGTGGCAGGGGGCAGG + Exonic
954121846 3:48504235-48504257 CAGGAGGAGGAGGAGGGAGGAGG + Exonic
954213380 3:49110915-49110937 CAGCAAGTAGATAAGGGGGCAGG - Intronic
954264492 3:49461850-49461872 GAGGAGGAGGAGAAGGAGGGTGG - Intergenic
954405738 3:50344112-50344134 CGGGCAGAGGATAAGGGTGCAGG - Intronic
954619715 3:51988634-51988656 GAAGGAGAGGAGTAGGGGGCTGG - Intronic
954634363 3:52063581-52063603 CAGGACGAGGAGAAGAGGGAGGG - Intergenic
954634592 3:52064695-52064717 CAGGCAGAGGAGAAGGGGAAAGG + Intergenic
954933269 3:54302852-54302874 CAGAAAGAGGAGATGAGAGCAGG - Intronic
955038524 3:55292509-55292531 CTGGAAGAGGACCAGGGGGCTGG - Intergenic
955087823 3:55720098-55720120 GAGGAGGAGGAGGAGGGGGATGG - Intronic
955283459 3:57616354-57616376 GAGGAGGAGGAGGAGGAGGCAGG + Intergenic
955314648 3:57926333-57926355 AAGGAAGAGGATAAGGAGGAAGG - Intronic
955478889 3:59369072-59369094 CAGGAAGAGGAGAAAGGTCAGGG - Intergenic
955945215 3:64187387-64187409 AAGGGAGGGAAGAAGGGGGCAGG - Intronic
955978226 3:64498367-64498389 AAAGCAGAGGAGAATGGGGCAGG - Intergenic
956080215 3:65549351-65549373 CAGGAAGAGGGGAGGGGAGGGGG - Intronic
956440904 3:69279690-69279712 GGGGAAGAGGAGAAGGAGGAGGG - Intronic
956440915 3:69279721-69279743 GGGGAAGAGGAGAAGGAGGAGGG - Intronic
956482656 3:69688597-69688619 GAGGAAGAGGGGGAGGGGGAGGG - Intergenic
956741565 3:72279920-72279942 AAGGAAGAGGAGGAGGGAGAGGG + Intergenic
957212086 3:77272399-77272421 CAGGAGGAAGAGAAGGGCGGGGG + Intronic
958115517 3:89211694-89211716 GAGGAAGAGGAAGAGGGGGAGGG - Intronic
958154597 3:89740355-89740377 GAGGAGGAGGAGAAGGAGGGGGG + Intergenic
958603050 3:96323635-96323657 GAGGAGGAGGAGAAGGCGGGGGG + Intergenic
958719040 3:97822294-97822316 GAGGAAGAGGAGGAGAGGCCGGG + Exonic
958732513 3:97974121-97974143 GAAGAAAAGGAGAAGGGGCCAGG + Intergenic
959963814 3:112332219-112332241 AAGGAGGAGGAGGAGGGGGAGGG + Intergenic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960183771 3:114613986-114614008 AAGGATGAGGAGAAGGAGGTGGG - Intronic
960350374 3:116585715-116585737 AAGGAAGAGGAGGAGGAGGCTGG + Intronic
960350383 3:116585757-116585779 AAGAAAGAGGAGAAGGAGGAGGG + Intronic
960914601 3:122682668-122682690 GAGGAAGAGGAGTAGTGGGCTGG - Intronic
961101450 3:124202598-124202620 CAGGAGGAGGAGGAGGAGGGAGG - Intronic
961236939 3:125375237-125375259 GAGGAAGAGGAGAAAGGCGCAGG - Exonic
961357436 3:126347971-126347993 CAGGAAGAAGAGACGCGGCCTGG + Intronic
961379111 3:126485949-126485971 AAGGATGAGGAGAAAGGGACAGG + Intronic
961386738 3:126527085-126527107 GTGGAATAGGGGAAGGGGGCTGG - Intronic
961487512 3:127227270-127227292 GAGGAGGAGGAGGAGGGGGAGGG - Intergenic
961508019 3:127384229-127384251 CAGGAGGAGGAGGTGGGGGAGGG + Intergenic
961937203 3:130597844-130597866 CAGGAAGAGAAAGAGGGAGCTGG + Intronic
962415160 3:135175134-135175156 AGGGAAGAGCAGAAGAGGGCTGG - Intronic
962444572 3:135453118-135453140 CAAGAGGAGGTGAAGAGGGCGGG - Intergenic
962462590 3:135628371-135628393 CAGGAAGTGGGGAAGGAGGAAGG - Intergenic
962486639 3:135849923-135849945 GAGGAAGAGGGGGAGGGGGAGGG + Intergenic
962498405 3:135965681-135965703 GAGGAGGAGGAGAAGGAGGTAGG + Exonic
962744932 3:138390020-138390042 CAAGAAGGGGAGAAGGGAGGAGG + Intronic
963335675 3:143971779-143971801 CAAGAAGGGGAGCCGGGGGCGGG - Exonic
963480352 3:145865466-145865488 CCAGAAGAGGAGAAAGGGGGAGG + Intergenic
963600960 3:147378465-147378487 AAGGAAGAGGAAAAAGGGGAAGG + Intergenic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
963836828 3:150066690-150066712 GAGGAAGAGGAGGAGGAGGAGGG + Intergenic
963836831 3:150066696-150066718 GAGGAGGAGGAGGAGGGGGAAGG + Intergenic
963850679 3:150207511-150207533 CTGGAAGAGGAGGAGCGGGAAGG - Intergenic
964452674 3:156826633-156826655 GAGGAGGAGGAGGAGGGTGCGGG - Exonic
964452676 3:156826639-156826661 CCGGAAGAGGAGGAGGAGGAGGG - Exonic
964546348 3:157838656-157838678 CAGGCAGCGGCGATGGGGGCTGG - Intergenic
964568139 3:158080881-158080903 GAGGAGGAGGAGGAGGGGGAGGG + Intergenic
964700801 3:159563977-159563999 TAGGAACGGGAGAATGGGGCAGG - Intronic
965079751 3:164021049-164021071 AAGGATGAGGAGAAGGCGGAGGG + Intergenic
965338355 3:167455809-167455831 GAGGAAGAGAAACAGGGGGCAGG + Intronic
965400346 3:168205988-168206010 CAAGATGGGGAAAAGGGGGCCGG - Intergenic
965409028 3:168306488-168306510 CAGGAAGGGGAGTAAGGGGATGG + Intergenic
966075616 3:175933476-175933498 CAGGAAAGGGAGCAGGGGACAGG + Intergenic
966075735 3:175935223-175935245 GAGCAAGAGGAAGAGGGGGCGGG - Intergenic
966099187 3:176245396-176245418 CAGAAGGAGGAGAAGGGAGATGG + Intergenic
966268775 3:178080184-178080206 CATGAAAAGGAGAAGGTGGGAGG - Intergenic
966314508 3:178630684-178630706 CAAGAAAAGGAGAAGGGAGGAGG - Intronic
966521915 3:180882423-180882445 GAGGAGGAGGAGAAGGAGGAAGG - Intronic
966593953 3:181710614-181710636 GAGGAGGATGAGATGGGGGCGGG - Intergenic
966809751 3:183833134-183833156 CAGGCAGGGGAGAGGAGGGCAGG + Intronic
966852755 3:184174877-184174899 CGGGCAGACGAGCAGGGGGCGGG + Exonic
966860231 3:184227645-184227667 CAGGATGAGGGGCAGGGGGTGGG - Intronic
967255859 3:187591231-187591253 CAGGGGGAGGGGCAGGGGGCGGG + Intergenic
967277374 3:187789905-187789927 AAGGAAGAGGGGAAGGAGGGAGG + Intergenic
967277979 3:187795314-187795336 AAGGAAGAAGAGAAGGAGGGAGG + Intergenic
967570257 3:191019867-191019889 CAGGAAGAGAAGGAGATGGCAGG - Intergenic
967821678 3:193844528-193844550 AAGGAAAAAGAGAAAGGGGCTGG + Intergenic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
967984186 3:195083100-195083122 CAGGAAGAGACGCTGGGGGCCGG - Intronic
968077358 3:195823876-195823898 CAGGAAGAGGTGGGGAGGGCAGG + Intergenic
968131001 3:196192770-196192792 CAGGAGGAGGAGCAAGGGGAAGG + Intergenic
968136644 3:196224673-196224695 TTGAAAGAAGAGAAGGGGGCGGG + Intronic
968196552 3:196712140-196712162 CGGGAAGCGGAGGTGGGGGCCGG + Exonic
968229260 3:196995670-196995692 CAGGAAGAGAAGGAGGGAGCAGG + Intronic
968603961 4:1522812-1522834 CAGGCAGAGGGGGAGGGGCCAGG - Intergenic
968651260 4:1761152-1761174 CAGTGACAGGAGATGGGGGCGGG - Intergenic
968663856 4:1810261-1810283 CACGCTGAGGAGGAGGGGGCTGG - Intergenic
968889233 4:3359058-3359080 GAGGAAGAGGGGGAGGGGGAGGG - Intronic
968961216 4:3744584-3744606 CAGGACCGGGAGAAGGGGTCTGG + Intergenic
969091852 4:4700204-4700226 CAGGTAGAGGAGATGGTGGCTGG + Intergenic
969100605 4:4765416-4765438 ATGGAAGTGGAGAAGGTGGCAGG - Intergenic
969670498 4:8587494-8587516 GAGGAGGAGGAGGAGAGGGCCGG + Exonic
969713240 4:8856462-8856484 TAGGAGGAGGAGAAGAGGCCGGG + Intronic
969979534 4:11140494-11140516 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
970099141 4:12501318-12501340 AAGGAAGAGGAGAAGAAGGAAGG + Intergenic
970506730 4:16738384-16738406 CAGGAAGAGGAGGAGGAGGAAGG + Intronic
970943997 4:21668997-21669019 GAGGAGGAGGAGAAGCAGGCAGG - Intronic
971094666 4:23387296-23387318 CAGGAAATGGAGAAGGGTGCAGG - Intergenic
971218080 4:24680540-24680562 AAGGAAGAGAAGAAGAGGGAAGG + Intergenic
971394164 4:26213418-26213440 TAGGAAAATGAGAAGGGGTCAGG + Intronic
972032382 4:34477783-34477805 GAGGAGGAGGAGGAGGGGGTGGG - Intergenic
972570122 4:40303100-40303122 CAGGAAGGAGAGAAGGAGGCCGG + Intergenic
972633234 4:40859798-40859820 CTGGAAGAAGAAAAGGGGACTGG - Intronic
972945516 4:44249782-44249804 AAAGAGGAGGGGAAGGGGGCAGG - Intronic
972990497 4:44817683-44817705 GAGGAAGAGGAGAAGGAGGAAGG + Intergenic
973076908 4:45940413-45940435 AAGGAAGAAAAGAAGGGGGAAGG + Intergenic
973836911 4:54819023-54819045 TAGGAAGAGGAGAAGAGGGGAGG - Intergenic
973919326 4:55668783-55668805 CAAGAAGAGGACAAGGGTGTAGG - Intergenic
974389624 4:61249429-61249451 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
975360210 4:73460925-73460947 AAGGAGGAGGGGAAGGGGGAGGG - Intergenic
975948987 4:79745064-79745086 TAGGAAGAGGAGAAGGAAGTGGG - Intergenic
976398544 4:84583053-84583075 TAGGAGGAGGAGAAGGGGCGGGG - Exonic
976640697 4:87334571-87334593 GAGGAAGAGGAGGAAGGGGAAGG - Intergenic
976897423 4:90128286-90128308 GGGGAAGGGGAGGAGGGGGCGGG + Intronic
977148949 4:93484237-93484259 GAGGAAAAGGAAATGGGGGCTGG - Intronic
977295276 4:95202689-95202711 CAGGTGGAGGTGAAGAGGGCAGG + Intronic
977990980 4:103442304-103442326 GGGGAAGAGGAGAAGGGGGAAGG - Intergenic
978702311 4:111662595-111662617 GAGGAGGAGGAGGAGGGGGAGGG + Intergenic
978777248 4:112516252-112516274 CAGGAGGAGGAGGCGGTGGCGGG - Intergenic
978828172 4:113049618-113049640 CAGGAGGAGGAGGAGGGGTGGGG - Intronic
979192085 4:117874269-117874291 CAGGAAGAGGAGAAGGGAGGAGG - Intergenic
980190677 4:129520487-129520509 GAGGAAGAAGAGAAGGAGGAGGG + Intergenic
980669482 4:135986075-135986097 GAGAAAGAGGAGAAGGTAGCTGG + Intergenic
980844912 4:138312811-138312833 GAGGAGGAGGAGAAAGGGGCAGG - Intergenic
980908382 4:138971559-138971581 CTGGAAGAGGTGAAAGAGGCAGG + Intergenic
980931769 4:139189003-139189025 GAGGAGGAGGAGGAGGAGGCTGG - Intergenic
980981428 4:139657582-139657604 GAGGAGGAGGAGAAGGGAGGGGG + Intergenic
981184588 4:141785970-141785992 CAGGAAGAGGAGGAGGAGGGGGG - Intergenic
981577229 4:146218060-146218082 GAGGAAGAGGGAAAGGGAGCTGG + Intergenic
981767054 4:148263027-148263049 CAGGGAGTGGAGATGGTGGCAGG - Intronic
981817098 4:148843097-148843119 CAGGAAGAGGAGAAGGAAGCAGG - Intergenic
982948029 4:161651516-161651538 AAGGAAGAGAAGAAAGGGGAAGG + Intronic
983026708 4:162746800-162746822 CAGGAAGGGGAGGAGAGGGGAGG + Intergenic
983059587 4:163142868-163142890 CTGTATGAGGAGAAGTGGGCCGG - Intronic
983577026 4:169271061-169271083 GAGGAAGAGGAGGAGGAGGCCGG + Exonic
984217059 4:176926579-176926601 CAGTGAGAGGAAAAGAGGGCCGG + Intergenic
984628922 4:182039939-182039961 AGGGAAGGGGAGAAGAGGGCAGG + Intergenic
984629018 4:182040180-182040202 AGGGAAGGGGAGAAGAGGGCAGG + Intergenic
984850774 4:184150619-184150641 CAGGAAGATGAGAGGGTGCCAGG + Intronic
985117353 4:186605248-186605270 AAGGAAGAGGAGGAGTGGGGAGG + Intronic
985190292 4:187365497-187365519 CAGGAAGTGGGGAGAGGGGCTGG - Intergenic
985202084 4:187494332-187494354 GAGGAAGAGAGGGAGGGGGCAGG - Intergenic
985475498 5:76704-76726 GAGGAGGAAGAGATGGGGGCTGG + Intergenic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985627643 5:998184-998206 GAGAAAGAGGAAAAGGGGGACGG + Intergenic
985652172 5:1112300-1112322 CAGCAGGAGGGGCAGGGGGCTGG - Intergenic
985657006 5:1137526-1137548 CAGGTTGAGGAGGAGGGGGAAGG - Intergenic
985774119 5:1831787-1831809 CAGGAGGAGGAGCCGGGGGAAGG - Intergenic
985913011 5:2897639-2897661 GAGGAAGAAGAGAAGGTGACAGG - Intergenic
986241277 5:5961924-5961946 CATGAAGTGGAGAAAGGGCCAGG - Intergenic
986269293 5:6217339-6217361 GAGGAACAGGAAAAGGGCGCTGG + Intergenic
986365249 5:7022563-7022585 CAGGAAAGAGAGAAGGTGGCAGG + Intergenic
986387521 5:7249041-7249063 AAGGCAGAGGAGAAGGCGGCTGG + Intergenic
986517230 5:8576354-8576376 CAGGAAGAAGTGATGTGGGCTGG + Intergenic
986700621 5:10404732-10404754 GAGGAAGAGGAGGAGGGGTCAGG + Intronic
987214638 5:15721535-15721557 CAGAGAGAGGAGAAAGGGGAAGG - Intronic
987216909 5:15747102-15747124 CAGAAAGATGAGAAGGGAGGTGG + Intronic
987312890 5:16697832-16697854 CAGGAAGAGGAGACCTGGGGAGG + Intronic
987503679 5:18744318-18744340 CAGGAAGAGGATATTGTGGCCGG + Intergenic
988449770 5:31330000-31330022 CAGGTAGAGGAGTGTGGGGCAGG + Intergenic
988791101 5:34608479-34608501 TGGGAAGACTAGAAGGGGGCAGG - Intergenic
989087877 5:37695157-37695179 CAGGAGTAAGAGAAGGGGGAGGG + Intronic
989539914 5:42606504-42606526 AAGAAAGAGGAGAAGGTGCCAGG + Intronic
989692360 5:44159299-44159321 CAGGAGGAAGATAAGGGGGAGGG + Intergenic
989724668 5:44574185-44574207 TAGGGAGAGGTGAAGGGGACTGG + Intergenic
989753715 5:44925622-44925644 TAAGAAGATGAGAAGGAGGCCGG - Intergenic
990018956 5:51101678-51101700 CAGGAAGAGTTGAAGTCGGCCGG + Intergenic
990019452 5:51107416-51107438 CAGGTAGAGGAGAGGGGAGACGG - Intergenic
990397408 5:55396475-55396497 AAGGAAGAGGAGGAAGAGGCAGG + Intronic
990499905 5:56385746-56385768 GAGGAGGAAGAGGAGGGGGCAGG - Intergenic
990946481 5:61254627-61254649 AAAGAAGAGGAGCAGGGGACTGG + Intergenic
990981024 5:61602603-61602625 CCAGAAGAGGAGAATGGGGGTGG - Intergenic
991331706 5:65499602-65499624 CAGAAAGAGGAGAAAGTGGGTGG - Intergenic
991588796 5:68226942-68226964 CAGGAAGAGGCCGAGGTGGCCGG - Exonic
991609292 5:68434288-68434310 CAGGCAGAGGGGACGTGGGCGGG + Intergenic
991664177 5:68981105-68981127 TGGGAAGCGTAGAAGGGGGCTGG + Intergenic
992116006 5:73539177-73539199 CATCAAGAGGAAAAGGGGGAAGG - Intergenic
992475417 5:77097142-77097164 AAGGAAGAAGAGAAGGAGGGAGG + Intergenic
992579267 5:78154541-78154563 GAGGAAGTAGAGAAAGGGGCAGG - Intronic
992595706 5:78345345-78345367 CATCAAGAGGAGAAGGTGGAGGG - Intergenic
993021136 5:82592477-82592499 GAGGAGGAGGAGAAGGAGGAAGG - Intergenic
993347501 5:86802882-86802904 GAGGAAGAGGAGGAAGGGGAGGG - Intergenic
993622556 5:90186160-90186182 GAGGAGGAGGAGAGGGGGGAAGG - Intergenic
993716128 5:91277355-91277377 GAGGAGGAGGAGAAGGGGGAGGG + Intergenic
994088673 5:95788207-95788229 CAGAATGAGGAGAATGGAGCTGG + Intronic
994541298 5:101101643-101101665 GAGGAGGAGGAGGAGGGGGAGGG + Intergenic
994710393 5:103258700-103258722 GAGGAGGCGGAGGAGGGGGCGGG + Exonic
994732041 5:103503651-103503673 CAGGAAGAGAAGAAGGGAGTGGG + Intergenic
994850269 5:105046311-105046333 GAGGAGGAGGAGGAGGGGGAGGG - Intergenic
995129054 5:108610460-108610482 AAGGAAGAGGTGAAGGAGGAGGG + Intergenic
995481477 5:112597416-112597438 CAGGAAGAAGACCAGAGGGCTGG - Intergenic
995539274 5:113168778-113168800 CAGGCAGCAGAGAACGGGGCAGG + Intronic
996167112 5:120237839-120237861 GAGGAAGAGGAGAGGGAGGGGGG - Intergenic
996337809 5:122403878-122403900 CAGGATAAGGAGAAGAGGGGAGG - Intronic
996415282 5:123203923-123203945 TAGGAAGAAGAGCAGGGTGCAGG - Intergenic
996653772 5:125914675-125914697 CAGGATGTGGAAAAGGGGTCAGG + Intergenic
996699435 5:126435471-126435493 CAGGGAGAGCAGAAGGGGGAAGG + Intronic
997195277 5:131975073-131975095 CAGGAAGAGGGGGAGGGGAATGG + Intronic
997434282 5:133863073-133863095 CAGAAATAGGGGAAGGTGGCAGG - Intergenic
997440707 5:133906948-133906970 AAGGAAGTGGAGAAGAGGGCGGG + Intergenic
997528264 5:134567180-134567202 AAGGAAGAGGTGAAAGGGGCTGG + Intronic
997676534 5:135717228-135717250 CAGAAAGAGGACCAGTGGGCAGG - Intergenic
997854213 5:137358534-137358556 AAGGAAGAGGGGAAGGTGGAGGG + Intronic
997893427 5:137695066-137695088 TTGGAAGAGGGGAAGGGGGAAGG - Intronic
997899814 5:137754228-137754250 AAGGAAGAGAGGAAGGGGGAGGG + Exonic
997981123 5:138467860-138467882 CCGGGAGAGGAGAAGGAGGTGGG - Exonic
998058739 5:139102625-139102647 AAGGAATGGGAGGAGGGGGCTGG - Intronic
998349029 5:141489007-141489029 CTGGAGGAGGAGAGGCGGGCTGG - Intronic
998490163 5:142539591-142539613 GAAGAAGAGGAGAAGGAGGAGGG - Intergenic
998516177 5:142756242-142756264 CTGGAAGCGGAGCAGAGGGCAGG - Intergenic
998929319 5:147163144-147163166 AAGGAAGAGAAGAAGGGGGAAGG - Intergenic
999125245 5:149241463-149241485 CTGAAAGATGAGAAGGGGCCTGG + Intronic
999137219 5:149329952-149329974 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
999273762 5:150314588-150314610 TTGGAGGAGGAGAAGAGGGCTGG - Intronic
999459592 5:151746453-151746475 CAGGAAGAGGAAATGGGGTATGG + Intronic
999592046 5:153158838-153158860 CAGGAAAAGGAAAAGCAGGCGGG - Intergenic
999616679 5:153432452-153432474 GAAGAAGATGAGAAGAGGGCTGG + Intergenic
999631979 5:153580772-153580794 CAGGAAGAGGAGCATGGAGTGGG + Intronic
1000599996 5:163261173-163261195 CAGGAAGAGGTGAAGGAGAAAGG + Intergenic
1001137872 5:169117418-169117440 TGGGAAGAGGTGAGGGGGGCAGG - Intronic
1001185413 5:169567001-169567023 CAGGAATAGGTGAAGGTGGAAGG - Intergenic
1001233575 5:170010457-170010479 CAGGAAGATGAGAAGGAGTAAGG + Intronic
1001274453 5:170340261-170340283 TAGAAAGAGGAGAGGGAGGCTGG - Intergenic
1001554438 5:172626355-172626377 CAGCAAGAGGAGAAGGAGAGAGG - Intergenic
1001706056 5:173741782-173741804 GAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1001737792 5:174021029-174021051 GAGGAGGAGGAGAAGGGGAAGGG + Intergenic
1002010016 5:176271570-176271592 TAGGAAGGGGAGTAGGGGGTTGG + Intronic
1002118365 5:176983239-176983261 GAGGGAGAGGAGGAGGGGGAGGG - Intronic
1002185590 5:177453455-177453477 CAGGCCCAGGAGAAGGGGACTGG + Intronic
1002187155 5:177459677-177459699 GAGGAAGAGGAGGAGGAGGAAGG + Intronic
1002201141 5:177529075-177529097 TGGGAAGAAGAGAACGGGGCAGG + Intronic
1002216718 5:177640734-177640756 TAGGAAGGGGAGTAGGGGGTTGG - Intergenic
1002532802 5:179858696-179858718 CCGGAGGAGGAGGAGGGGGCTGG + Intronic
1002647630 5:180668810-180668832 CAGGAAGAAGAGAACGAGACAGG + Intergenic
1002661434 5:180793156-180793178 CAGGTAGAGGAAATGGGGGCAGG + Intronic
1002916767 6:1535411-1535433 CAGGAAGCGGAGGGTGGGGCAGG + Intergenic
1003119011 6:3304883-3304905 CAGGGAGAGGAGAGGGATGCAGG + Intronic
1003171058 6:3722504-3722526 CAGGAAGAGGGGGAGGGACCAGG + Intergenic
1003856940 6:10286045-10286067 GAGGAGGAGGAGAAGGAGGGAGG + Intergenic
1003914276 6:10771095-10771117 CAGGCAGAGGGCAAGTGGGCAGG + Intronic
1004017056 6:11741785-11741807 GAGAGAGAGGGGAAGGGGGCAGG - Intronic
1004069236 6:12282563-12282585 GAGGAAGAGGAGAAAGGATCAGG - Intergenic
1004119672 6:12808828-12808850 GAGGAGGAGGAGGAGGGGGAGGG - Intronic
1004324219 6:14659212-14659234 GCGGAAGAGGAGAAGGGAGCTGG - Intergenic
1004515110 6:16315975-16315997 TATAAAGAGGAGAAGGGGCCAGG - Intronic
1004698564 6:18057248-18057270 CAGGAACAGCAGGAGGGGGATGG - Intergenic
1004880196 6:19999913-19999935 CAGGAAGAGAAAAAGAAGGCAGG - Intergenic
1005114672 6:22322430-22322452 CTAGAAGAGGGGATGGGGGCTGG - Intergenic
1005446562 6:25930112-25930134 CAGGAAAAGGAGAACATGGCCGG - Intronic
1005509231 6:26497458-26497480 CATGAAGAGGAAAATGGGACAGG + Intergenic
1006029051 6:31165812-31165834 CATGAAGAGGAGTAGGGAGAGGG - Intronic
1006197515 6:32254971-32254993 CGGGAAGAGGGGATGGGGGTGGG + Intergenic
1006243041 6:32703482-32703504 CAGGAAGAGAAGACGGAGGTTGG - Intergenic
1006247214 6:32747888-32747910 AAGGGGGAGGAGCAGGGGGCTGG - Intergenic
1006291691 6:33142775-33142797 GAAGAAGAGGAGGAGGGGGAGGG + Intergenic
1006335900 6:33420372-33420394 CAGGGGGAGGGGCAGGGGGCGGG + Intronic
1006376998 6:33677156-33677178 CAGGGAGAGGCACAGGGGGCCGG - Intronic
1006391434 6:33761309-33761331 CAGGCAGGAGAGAAGGGGACGGG - Intergenic
1006402507 6:33826051-33826073 AAGGGAGGGGAGGAGGGGGCAGG - Intergenic
1006437807 6:34035299-34035321 GAGAAAGAGGAGGAGGGGGAAGG + Intronic
1006562976 6:34929777-34929799 AAGGAAAAGGGGAAGGGGGAGGG - Intronic
1006632846 6:35441679-35441701 GAGGAGGAGGGAAAGGGGGCGGG + Intergenic
1006650193 6:35545043-35545065 CAAGAGGAGGAGGAGGGGACAGG + Intergenic
1006735151 6:36268093-36268115 AAGGAAGATGAGACTGGGGCTGG - Intronic
1007088068 6:39164487-39164509 CAGGAAGTGGAGAAAGGGATTGG + Intergenic
1007280180 6:40706450-40706472 CAGGAACAGGAGACAAGGGCTGG + Intergenic
1007377379 6:41466171-41466193 AAAGAAAAGGAGAAGGGGGCCGG + Intergenic
1007586341 6:42992353-42992375 CAAGAAAAGGGCAAGGGGGCCGG - Intronic
1007705160 6:43786537-43786559 GAGGAAGAGGGAAAGGGGGCGGG - Intergenic
1007722208 6:43891707-43891729 CAGGTAGAGGAGCAGGGGAGGGG + Intergenic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1007827105 6:44608762-44608784 GAGGAGGAGGAGAAGGAGGATGG - Intergenic
1007879423 6:45146425-45146447 CAGGAAGAAGGGATGGAGGCGGG + Intronic
1007927635 6:45663201-45663223 CAGGAAGAGGAGGAGGGAGATGG - Intronic
1008016429 6:46525630-46525652 AAGGAAGAGAAGAAGGGGGAGGG + Intergenic
1008328675 6:50218898-50218920 AAGAAAGAGAAGAAAGGGGCTGG - Intergenic
1008908179 6:56703643-56703665 GAGGATGAGGATAAGGGGGTAGG - Intronic
1010041671 6:71391907-71391929 GAGGAAGAGGAAAATGAGGCTGG - Intergenic
1010155292 6:72785351-72785373 CAAGAACAGGAGCAGGGGTCAGG + Intronic
1010355681 6:74930024-74930046 GAGGAAGAGGAGAAGTAGGAAGG + Intergenic
1011484757 6:87830004-87830026 AAGGGAGAGGAGAAGGAGGAAGG - Intergenic
1011778696 6:90761881-90761903 GAGGAAGAAGAGGAGGGGCCTGG + Intergenic
1011843346 6:91529306-91529328 AAGAAAGAGGAGAGGGAGGCAGG + Intergenic
1013075594 6:106768296-106768318 CAAGAAGAGCAGAAGAGGGAAGG + Intergenic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1013691865 6:112654515-112654537 CAGGAAGACGAGAAGGATCCAGG + Intergenic
1014074660 6:117222434-117222456 CTGGAAGAGGAGAATAGGGGAGG - Intergenic
1014318329 6:119894464-119894486 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1014465401 6:121750370-121750392 AAGGAAGAGGAAAATGGGGCAGG + Intergenic
1014684380 6:124477738-124477760 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1015939167 6:138431542-138431564 CAGGAGGAGGAGGAGGAGCCGGG + Exonic
1016295549 6:142569760-142569782 CAGGAAGAGGGAAAGGGTGGAGG + Intergenic
1016330103 6:142945960-142945982 GAGGAGGAGGAGAAGGAGGACGG + Intergenic
1016749178 6:147613732-147613754 GAGGAAGAGCAGAAGGGGGAAGG + Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017000915 6:149996422-149996444 CCTGCAGAGGAGGAGGGGGCAGG + Intergenic
1017001455 6:150000263-150000285 CAGGATGAGTTGAGGGGGGCAGG - Intergenic
1017041836 6:150314319-150314341 GAGGAAGAGGAAAAGGAGGAGGG + Intergenic
1017192208 6:151666690-151666712 GAGGAGGAGGAGGAGGGGGATGG - Intronic
1017199888 6:151741189-151741211 CAGGAAGAGGAGACAGGGAAGGG - Intronic
1017243654 6:152197999-152198021 CAGGAAGGGGAGAGGAGGGGAGG + Intronic
1017339615 6:153305369-153305391 AAGGAGGAGGAGAAGGGGAAGGG - Intergenic
1017437439 6:154429707-154429729 GAGGAGGAGGAGACGGGGGAGGG - Intronic
1017503384 6:155045944-155045966 GAGGAAGAGGAGGGGCGGGCGGG + Intronic
1017637428 6:156456324-156456346 GAGGAAGGGGAGAAGGGGGAGGG - Intergenic
1017857061 6:158359141-158359163 GAGGAAGAGGGGAGGGTGGCTGG - Intronic
1018220202 6:161570495-161570517 GAGGAGGAGGAGGAGGGGGAAGG - Intronic
1018304878 6:162444545-162444567 TAGGAAGAGGAGAAGGAGGGAGG - Intronic
1018336172 6:162792302-162792324 CAGAAATAGGAGTAAGGGGCAGG + Intronic
1018378095 6:163232478-163232500 AAGGAAGAGGAGAAGGAAGAAGG + Intronic
1019165536 6:170095477-170095499 CAGGAACAAGCGCAGGGGGCTGG - Intergenic
1019168742 6:170116843-170116865 CAGGAGGAAGAGCAGGAGGCTGG + Intergenic
1019313440 7:373874-373896 AAGGAAGAAAAGAAGGGGGGGGG + Intergenic
1019421718 7:954040-954062 CAGAAAGAGGAAATCGGGGCTGG - Intronic
1019517498 7:1446370-1446392 GAGGAGGAAGAGAAGGGGGGAGG + Intronic
1019551837 7:1606927-1606949 CACGAAGAGGAGGAGGAGGAGGG - Intergenic
1019552469 7:1610026-1610048 CAGGAGGAGAAGCGGGGGGCTGG + Intergenic
1019562828 7:1666631-1666653 CAGAAAGAGGGGGAGGGGGCTGG + Intergenic
1019705436 7:2495114-2495136 CGAGAAAAGGAGAGGGGGGCCGG + Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019942911 7:4305371-4305393 CAGGAGGAAGAGGAGGGGGTTGG - Intergenic
1019971503 7:4544510-4544532 CATGAAGAAGAGAAGAGAGCGGG - Intergenic
1020086408 7:5313035-5313057 GAGGAGGAGGAGGAGGAGGCCGG + Exonic
1020410714 7:7888870-7888892 GAGGAGGAGGAGGAGGGGGAGGG + Intronic
1020577336 7:9949778-9949800 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1020808829 7:12826311-12826333 GAGGAAGAGGATGAGGGGGAAGG - Intergenic
1021100914 7:16585435-16585457 CAGGAAGGTGAGATTGGGGCAGG + Intergenic
1021211978 7:17864776-17864798 GAGAAGGAGGAGAAGGGGGAGGG + Intronic
1021482919 7:21137354-21137376 CAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1021647706 7:22802545-22802567 CAGGGGGAGGAGAAGGGGGCTGG - Intergenic
1021993614 7:26159161-26159183 CAGCAAGAGCAGCTGGGGGCTGG - Intronic
1022015748 7:26346936-26346958 CAGGGAGAGGCTCAGGGGGCGGG - Intronic
1022129945 7:27395786-27395808 CAGCAGGGAGAGAAGGGGGCAGG + Intergenic
1022135660 7:27445681-27445703 GAGGAAGGGGAGAAGAGGGATGG + Intergenic
1022175626 7:27869506-27869528 CATGGGGAGGAGAAGGGGGATGG - Intronic
1022243582 7:28535403-28535425 AAGGAAGAAGAGAGGGAGGCAGG + Intronic
1022475853 7:30709042-30709064 CATGAAGATGAGATGGGGGGAGG + Intronic
1022633844 7:32112290-32112312 GAAGAAGAGGAGAAGGAGGAGGG - Intronic
1022638538 7:32160076-32160098 CAGGAGGAGTGGAAAGGGGCTGG + Intronic
1022715454 7:32893953-32893975 CAAGAAGAGGGGAAAGGGGGTGG + Intronic
1022834079 7:34097178-34097200 CAAAAAGAGGAGCAGGAGGCTGG + Intronic
1022935064 7:35166292-35166314 AAGGAAGGGGAAAAGGGGGAAGG - Intergenic
1023026336 7:36053846-36053868 GAGGAAGAGGAGGAGGTGGGAGG - Intergenic
1023045174 7:36204423-36204445 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1023049236 7:36236575-36236597 CAGTAAGAGGTGAAGCTGGCTGG + Intronic
1023082620 7:36539409-36539431 AAGGAAGAGGAACAGGGAGCTGG - Intronic
1023093003 7:36633635-36633657 CAGGACGGGGAGCAGGGGCCTGG + Intronic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023608829 7:41954401-41954423 CCTGGAGAGGGGAAGGGGGCTGG + Intergenic
1023710977 7:42992279-42992301 CAGGAGTAGCAGAAGGGGACAGG - Intergenic
1024080908 7:45854089-45854111 CGGGAAGGGGAGAAGAGGGGAGG + Intergenic
1024196418 7:47063872-47063894 GAGGGAGAGGAGGAGGGGGAGGG - Intergenic
1024503130 7:50134965-50134987 TAAGAAGACGAGAACGGGGCAGG - Intronic
1024599020 7:50963311-50963333 GAGGAGGAGGAGGAGGGGGAGGG - Intergenic
1024946886 7:54817357-54817379 CAGGAAGACGAGAAGCAGGGAGG - Intergenic
1024994276 7:55260271-55260293 GAGGAAGAGCAGAAGGGGCGAGG + Intergenic
1025110379 7:56211501-56211523 CAGGGAGAGGTGAGGGGAGCAGG + Intergenic
1025123597 7:56327750-56327772 CGGGAAGGGGAGAAGAGGGGAGG - Intergenic
1025664037 7:63572796-63572818 GAGGAGGAGGAGGAGGAGGCCGG + Intergenic
1026294172 7:69036604-69036626 CAGGAGGAGGAGAAGCAGGTTGG + Intergenic
1026580169 7:71609075-71609097 CAGGAAGAGTAAAAGATGGCTGG - Intronic
1026638635 7:72105772-72105794 GAGGAGGAGGAGGAGGGGGGAGG + Intronic
1026678351 7:72446940-72446962 GAGGAAAAGCAGAAGGGGGAAGG + Intronic
1026957896 7:74389299-74389321 CAAGAAGAGGAGCAAGGGCCAGG - Intronic
1026962832 7:74420054-74420076 AAGGAAGAAGAGAAGGAGGGAGG - Intergenic
1027132246 7:75599325-75599347 CTGGAGGAGGAGAAAGGGGCGGG - Intronic
1027294136 7:76749459-76749481 AAGGAAGAGGAGAAGGATGAGGG - Intergenic
1027784686 7:82566105-82566127 AAGAAAGAGGAGAAAGTGGCCGG - Intergenic
1027814708 7:82953701-82953723 GAGGAGGAGGAGGAGGGGGAGGG + Exonic
1028070828 7:86448038-86448060 AAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1028433527 7:90775652-90775674 GAGGAGGAGGAGAAAGGGGGAGG - Intronic
1028931056 7:96413716-96413738 CAGGAGGTGGAGAAGGGGAGAGG - Intergenic
1028984565 7:96999325-96999347 CAGGAGGTGGAGATGGGGGTGGG - Intergenic
1029112255 7:98218310-98218332 CAGAAAGAGGATCAGGAGGCCGG - Intronic
1029309641 7:99650730-99650752 GAGGCAGAGGAGAAGGTGGACGG - Intronic
1029446318 7:100614888-100614910 CAAGAAGAGGAGGAAGGAGCTGG - Exonic
1029479666 7:100804942-100804964 CAGGAGGAGGTGAGGCGGGCAGG + Intronic
1029524551 7:101087077-101087099 GAGGAGGAGGAGAAGGAGGAGGG + Exonic
1029635044 7:101777961-101777983 CAGGAAGAGGAAGAGGGTGCCGG + Intergenic
1029657602 7:101937219-101937241 CAGGGGGAGGAGCTGGGGGCTGG - Intronic
1029675958 7:102069094-102069116 GAGGAGGAGGAGAGGGCGGCTGG - Intronic
1029831016 7:103259059-103259081 AAGGAAGGGGAAAAGGGGGAAGG - Intergenic
1030073696 7:105719215-105719237 GAAGAAGAGAAGAAGGGGGATGG - Intronic
1030130320 7:106194149-106194171 GAGGAATAGGAGGAGGGAGCTGG + Intergenic
1030547409 7:110914091-110914113 CAGGAAGAGCAAAAGCAGGCTGG - Intronic
1030614941 7:111729261-111729283 CAGATAGAGGAGAAAGGAGCTGG + Intronic
1030684567 7:112471450-112471472 CAGGGAGAGGAGAAAGGAGATGG - Intronic
1030781863 7:113610711-113610733 GAGGAGGAGGGGAAGGGGGGAGG + Intergenic
1031123059 7:117742965-117742987 CAGGAAGAGGTGAAGCAGGCTGG - Intronic
1031417581 7:121511246-121511268 CTGTAAGAGGAGGAGGGGGTAGG + Intergenic
1031543367 7:123023322-123023344 CAGATAGAGGAGATGGGGGTTGG + Intergenic
1031955396 7:127937446-127937468 GAGGGAGAGGAGAAGGGAGAAGG - Intronic
1031973442 7:128079473-128079495 CTGGAAGGTGAGAAGGGGTCAGG + Intronic
1032092904 7:128920579-128920601 CAGGCAGAGCAGAAGGAGGTCGG - Intergenic
1032173544 7:129605812-129605834 CAGATAGAGGGGAAGCGGGCGGG - Intergenic
1032286065 7:130539276-130539298 GAGGAAGAGGAGGAAGTGGCGGG + Intronic
1032329270 7:130962540-130962562 CAGGAGGAAGATAAGGGGGAAGG - Intergenic
1032492396 7:132333388-132333410 CAGGAAGAGGAAGAGGGAGGTGG + Intronic
1032523186 7:132561567-132561589 GAGGAAGAGGAGGAGGGGAAAGG - Intronic
1032523564 7:132563183-132563205 GAGGAAGAGGAGGAGGAGGAAGG - Intronic
1032529329 7:132607314-132607336 CAGGAGGGGGAGAAGGTGGAAGG - Intronic
1032707210 7:134431821-134431843 CAGGAAGAAAAGAAAGAGGCTGG + Intergenic
1032751152 7:134843084-134843106 AAGGAAGACGGGAAGGGAGCTGG - Intronic
1033308157 7:140239766-140239788 GAGGGAGAGAAGGAGGGGGCGGG + Intergenic
1033378744 7:140791236-140791258 CAGTAAGAGGAGAAGGCAGCAGG - Intronic
1033614850 7:143004234-143004256 CTGGAGGAGGAGGAGGGGGTTGG + Intergenic
1033896208 7:146073899-146073921 CAGTAATACGGGAAGGGGGCAGG + Intergenic
1033956389 7:146854054-146854076 CAGGGAGATGAGAAGGAGGCTGG + Intronic
1034014397 7:147566361-147566383 GGGGAAGGGGAGAAGGGGGGTGG + Intronic
1034248608 7:149670042-149670064 AAGGAGGAGGAGGAGGGAGCAGG - Intergenic
1034255923 7:149724665-149724687 CAGGATGGGGAGGAGGGGTCAGG - Exonic
1034413857 7:150955036-150955058 CAGGACCAGGAGAAGCCGGCAGG - Intronic
1034469249 7:151246858-151246880 CAGGAAGAAGATCAGAGGGCAGG + Intronic
1034702138 7:153105588-153105610 GAACAAGAGGAGAAGGGAGCAGG - Intergenic
1034835717 7:154350214-154350236 TAGGAAGGGGAGAAGGAAGCAGG + Intronic
1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG + Intergenic
1035398421 7:158549953-158549975 CAGGACGAGGGCAAGGGGGAGGG - Intronic
1035419704 7:158717345-158717367 CAGGAGGAGGAGAAGGAAGAAGG - Intergenic
1035579761 8:732106-732128 CAGGGAGACAAGAAGGGGTCTGG - Intronic
1035784116 8:2248778-2248800 CAGGAAGAGGAGCCAGGGGAAGG + Intergenic
1035793182 8:2326222-2326244 CAGGGAGAGGAGGTGGGGTCGGG + Intergenic
1035799622 8:2395483-2395505 CAGGGAGAGGAGGTGGGGTCGGG - Intergenic
1036099125 8:5757979-5758001 CAGGAGGAAGAGAGGGAGGCGGG - Intergenic
1036295213 8:7529236-7529258 AAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1036327357 8:7791782-7791804 AAGGAGGAGGAGAAGGGGGAGGG + Intergenic
1037218182 8:16483870-16483892 GAGGAAGAGGAGGAGGAGGATGG + Intronic
1037218195 8:16483930-16483952 GAGGAAGAGGAGGAGGAGGATGG + Intronic
1037270938 8:17129697-17129719 CAAGAAGAGGGGAAGAGGGTGGG + Intergenic
1037451982 8:19024698-19024720 CAGGAAGGGGAGAGGGGGTCTGG + Intronic
1037608014 8:20453771-20453793 GAAGAGGAGGAGAAGGAGGCTGG + Intergenic
1037737902 8:21581649-21581671 CAGGTGGAGGAGACGGAGGCTGG + Intergenic
1037806430 8:22060150-22060172 CAGGAAGAGGGGAGGGAGGGAGG - Intronic
1037934295 8:22904251-22904273 CTGGAAGAGGAGAAGGAGCCAGG + Intronic
1038120391 8:24607973-24607995 GAGGAAAAGGAGAAGGGGAGGGG + Intergenic
1038161364 8:25042162-25042184 AAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1038339542 8:26673923-26673945 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1038447312 8:27612934-27612956 GAGGAGGAGGAGAAGATGGCGGG + Intronic
1038483654 8:27918848-27918870 GAAGAAGAGGAGAAGGAGGAGGG + Intronic
1038507650 8:28099383-28099405 CAGGAAGACAAGAAGAAGGCTGG + Intronic
1038522442 8:28244721-28244743 CAGGAAGAGGAGGAGGGGAGGGG + Intergenic
1038596431 8:28890497-28890519 CAGGAAGAGGAGAAGGGGGAGGG - Exonic
1038711087 8:29946437-29946459 TAGGGAGAGGAGAAGGAGGGAGG - Intergenic
1038743344 8:30234754-30234776 GAGGAAGAGGGGAAGAGGCCAGG - Intergenic
1039184306 8:34899702-34899724 AAGGTTGAGGAGAAGGTGGCTGG - Intergenic
1039350512 8:36759029-36759051 CAGGAAGGGGACAAGAGTGCAGG - Intergenic
1039458931 8:37727317-37727339 CAGGAGGAGGGGAAGGGTGGAGG + Intergenic
1039473065 8:37826008-37826030 CAGGAAGAGGGGCTGGGGCCTGG + Intronic
1039542500 8:38382970-38382992 CAGGAAGAGGCGCGCGGGGCCGG - Intergenic
1039802432 8:40970887-40970909 CAGGAAGAAGATAAGGTGGAAGG - Intergenic
1040079752 8:43274856-43274878 GAGGAAGAGGAGGAGGGGGAGGG - Intergenic
1040079798 8:43274988-43275010 GAGGAAGAGGAGACGGAGGAAGG - Intergenic
1040101774 8:43512460-43512482 CAGGAGGAAGGGAAGAGGGCAGG - Intergenic
1040861145 8:52000477-52000499 CAGGAAGAGGAGGCAGAGGCAGG + Intergenic
1041063326 8:54057659-54057681 CTGGAAGGGTAGAAGGGGGCTGG + Intronic
1041145571 8:54872767-54872789 CAGGGTGGGGAGAAAGGGGCAGG - Intergenic
1041309733 8:56503162-56503184 CAGGGAAAGGAGATGGGGTCTGG + Intergenic
1042130429 8:65582486-65582508 AAGAAGGAGGAGAAGGGGGAGGG + Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042271137 8:66956906-66956928 TAAGAAGAGGAGAATCGGGCCGG + Intronic
1042343434 8:67704024-67704046 CTGGAGGAGGATAAGGGGCCTGG - Intronic
1042487633 8:69363916-69363938 AAGGAAGAGGAGCAGGGAGGGGG + Intergenic
1042542954 8:69925081-69925103 CAGCAAGGTGAGAAGGGTGCAGG + Intergenic
1042811143 8:72826439-72826461 CTGGAAGAAGAGAAGGCTGCGGG + Intronic
1043065877 8:75569252-75569274 CAGGAAGACTAGAAGGGGAAAGG - Intergenic
1043192025 8:77237596-77237618 GAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1043385588 8:79744634-79744656 AAGTAAAAGGAGAAGGGGGATGG + Intergenic
1043499475 8:80838567-80838589 GAGGAGGAGGAAAAGGGGGGAGG + Intronic
1044090327 8:87992533-87992555 TAGGAAGAGGAGGAGGAGGGGGG - Intergenic
1044395891 8:91711392-91711414 GAGGAAGAGGAAAAGGAGGAAGG + Intergenic
1044401830 8:91781657-91781679 CAGGCAGAGGAGATGGAGGGGGG - Intergenic
1044422933 8:92019406-92019428 AAGGAAGAGCAGGAGGGGGAGGG + Intronic
1044932020 8:97260133-97260155 CAGGAGAAGGAGGAGGGGGAGGG + Intergenic
1044953159 8:97452940-97452962 AAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1045089625 8:98728067-98728089 CTAGGAGAGGAGGAGGGGGCAGG - Intronic
1045231990 8:100314678-100314700 CAGGCAGAGGAGAGGGGAGGGGG - Intronic
1045322519 8:101092557-101092579 AAGGAGGATGGGAAGGGGGCAGG - Intergenic
1045491282 8:102671278-102671300 GTGGGAGAGGAGAAGTGGGCTGG - Intergenic
1045583455 8:103501697-103501719 CAGGAAGAGCAGCAGAGTGCAGG - Intronic
1045724831 8:105159995-105160017 AAAGAGGAGGAGAAGAGGGCAGG + Intronic
1046625464 8:116572311-116572333 GATGAAGAGAAGAAGGGGGAGGG - Intergenic
1046859916 8:119079096-119079118 AAGGAAGAGGACAAGGGGGAAGG - Intronic
1047036339 8:120942851-120942873 CAAGAATTGGAGAGGGGGGCTGG - Intergenic
1047227880 8:122971835-122971857 TAGGTAGAGGAAATGGGGGCAGG - Intronic
1047254781 8:123206993-123207015 GAGGAAGAGGAGGAGGGGAGGGG - Intronic
1047340060 8:123972492-123972514 AAGGAAGAGGAGAAGGATTCTGG - Intronic
1047454694 8:124998395-124998417 CAGGAGCAGGGGTAGGGGGCGGG + Intergenic
1047537683 8:125734488-125734510 CAGGAAGAGGGGAAGGGAGAGGG - Intergenic
1047624779 8:126645507-126645529 CAGGAAGAGCAGGAGAGGGAGGG - Intergenic
1048138549 8:131770496-131770518 CAGGAAGAGGACAAGAGACCTGG - Intergenic
1048515735 8:135108974-135108996 TAGGAAGGGTAGTAGGGGGCTGG - Intergenic
1048516580 8:135116818-135116840 GAGGAGGAGGAGAGGGGGGAGGG - Intergenic
1048829394 8:138461254-138461276 CAGGAAGTGGACCAGGGTGCTGG + Intronic
1048889432 8:138934481-138934503 GAGGAAGAGGAGGAGGGAGAAGG + Intergenic
1048985101 8:139730915-139730937 GAGGAACAGGAGGAGAGGGCTGG + Exonic
1048996376 8:139796103-139796125 GAGGAAGAGGAGGAGGGAGGAGG + Intronic
1049208929 8:141376440-141376462 CAGGAAGAGGTGAGGGAGCCTGG + Intergenic
1049366643 8:142240951-142240973 CAGGAACAAGACAAGGGTGCCGG + Intronic
1049403689 8:142442375-142442397 CTGGGAGAGGAGGAGGAGGCAGG - Intergenic
1049429016 8:142550669-142550691 CAGGAAGGGGAGGTGGGGGGAGG + Intergenic
1049442902 8:142617286-142617308 AAGGAACAGGGGAAGGGGGTGGG + Intergenic
1049632394 8:143665695-143665717 AAGGATGAGGACAAGGGGGATGG + Intergenic
1049653504 8:143787748-143787770 CAGGATGAGGGGAAGGAGGTGGG - Intergenic
1049820367 8:144629763-144629785 CAGGAAGAGGAGGAGGGCGCTGG + Intergenic
1049844280 8:144792518-144792540 CTGGAGGAGGAGAAGTAGGCGGG - Exonic
1050293395 9:4180187-4180209 CAAGGAGAGGAGATGGGGACTGG + Intronic
1050345351 9:4680167-4680189 CAGGAAGGGGAGATGGAGGAAGG - Intronic
1050537888 9:6645818-6645840 TAGGAAGAGGGGGCGGGGGCGGG - Intergenic
1050602466 9:7266820-7266842 TAGGAACAGGGGTAGGGGGCCGG - Intergenic
1050684000 9:8146920-8146942 CAGGAAGAAGAGAAGTAGGAAGG - Intergenic
1050744193 9:8857928-8857950 GAGGAGGAGGAAAAGGGGGTAGG - Intronic
1050992948 9:12174980-12175002 GAGGAAAAGGAGAAAGGAGCAGG + Intergenic
1051017611 9:12499596-12499618 AAAGCAGAGGAGAAGGAGGCAGG + Intergenic
1051444286 9:17124096-17124118 CAGCAAGAGGAGAAGAGGTCTGG + Intergenic
1051759021 9:20439586-20439608 CAGGAAGGGGAGTGGGGGGATGG + Intronic
1052416671 9:28186799-28186821 CAGCAAGAGGACCAGGGTGCCGG + Intronic
1052834379 9:33239808-33239830 CAGGAGGCAGAGAAGGGGGCTGG - Intronic
1052877009 9:33575026-33575048 CAGGAGGAAGAGAAGAGAGCAGG - Intergenic
1052916596 9:33928026-33928048 GAGGCAGAGGAGGAGGGTGCTGG + Intronic
1053162140 9:35820494-35820516 CCTGAAGAGGAGAAGGAGGTTGG + Intronic
1053263860 9:36696078-36696100 CAGGGACAGGAGAAGGGGTGAGG - Intergenic
1053441613 9:38120939-38120961 GAGGAGGAGGAGAAGGTGGGAGG + Intergenic
1053484748 9:38443259-38443281 CTGGGAGAGGAGAAGTGGGAGGG + Intergenic
1053498997 9:38569368-38569390 CAGGAGGAAGAGAAGAGAGCAGG + Intronic
1054907139 9:70421172-70421194 CAGGAGGAGAGGAAGGGGGAGGG - Intergenic
1054984904 9:71250715-71250737 CAGTAAGAAGGGCAGGGGGCAGG + Intronic
1054991475 9:71331964-71331986 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1055492032 9:76815136-76815158 CAGGTAGAGAAGATTGGGGCGGG - Intronic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1056380834 9:86055777-86055799 CAGGGATAGGAGAGGGGGGAGGG + Intronic
1056548628 9:87633921-87633943 GGAGAAGAGGAGAAGGGGGCAGG + Intronic
1056586572 9:87931329-87931351 CAGGAAGAAGAGAAGAGAGCAGG + Intergenic
1056610304 9:88121613-88121635 CAGGAGGAAGAGAAGAGAGCAGG - Intergenic
1057004714 9:91547060-91547082 CAGGAAAAGGAGTCAGGGGCAGG + Intergenic
1057079528 9:92162217-92162239 CTGGAAGAGAAGAAGGGAGAGGG + Intergenic
1057181525 9:93033294-93033316 GAGGAGGAGGAGAAGGGGACGGG - Intronic
1057181534 9:93033317-93033339 GAGGAGGAGGAGAAGGGGACGGG - Intronic
1057181543 9:93033340-93033362 GAGGAAGAGGAGAAGGGGACGGG - Intronic
1057478247 9:95423451-95423473 TAGGAACAGGAGGAGGGGGAAGG + Intergenic
1057497397 9:95571919-95571941 GAGGAAGAGGAGCAGAGGGAAGG + Intergenic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1057678434 9:97153857-97153879 CAGGAGGAAGAGAAGAGAGCAGG + Intergenic
1057761614 9:97879173-97879195 GAGGAAGAGGAGACAGGAGCAGG - Intergenic
1057810268 9:98251984-98252006 CAGGAAGAGGGGAAGGTTGTGGG + Intronic
1057835809 9:98444283-98444305 AAGGATGAGTAGAGGGGGGCTGG + Intronic
1057891722 9:98874790-98874812 CTGGAAGAGGAGAAAGGAGGTGG - Intergenic
1058102542 9:100933264-100933286 CGGGGAGGGAAGAAGGGGGCAGG - Intergenic
1058444581 9:105043437-105043459 GAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1059228521 9:112695766-112695788 AAGGGAGAGGAGGAGGGGGAGGG + Intronic
1059300669 9:113310393-113310415 AAGGCTGAGGGGAAGGGGGCAGG - Intergenic
1059306264 9:113355510-113355532 GAAGAAGAGGGGAAGAGGGCAGG - Intronic
1059402069 9:114076817-114076839 GAGGAAGAGGAGGAGGTGGAGGG - Intronic
1059542524 9:115144377-115144399 GAGGAAAAGGAGAAGGGGAGGGG - Intronic
1059663961 9:116428227-116428249 AAAGAAGAGGAAAAGGTGGCCGG + Intronic
1059671652 9:116497714-116497736 CAGGCTGGGGAGAAGGGGGAGGG + Intronic
1059733071 9:117075503-117075525 GGGGAGGAGGAGGAGGGGGCAGG + Intronic
1059931088 9:119261872-119261894 GAGGAAGAGAAGAAGGAGGAGGG - Intronic
1060089079 9:120727332-120727354 CAGGAATAGCAGAAGGGCTCTGG + Intergenic
1060159080 9:121343705-121343727 CAGGAAGAGGGGAAAGGTGGGGG + Intronic
1060168751 9:121443194-121443216 CAGGCAGAGGAGTAGGTGGAAGG - Intergenic
1060237256 9:121873611-121873633 GAGGAGGAGGAGGAGGAGGCGGG - Intronic
1060397526 9:123326596-123326618 CAGGGAGAGGAGAGGTGGGGAGG - Intergenic
1060406805 9:123376899-123376921 CAGGAGGAGGAGGAGGAGGCAGG - Exonic
1060943632 9:127557467-127557489 CAGGAAGAGGGGAGGGAGGGCGG + Intronic
1061183053 9:129036465-129036487 TAGGAGGAGGGGAAGAGGGCGGG + Intergenic
1061204125 9:129153192-129153214 CAAGCAGAGGAGCAGTGGGCTGG + Intergenic
1061237512 9:129351424-129351446 CAGGAGGAGGAAAGGGGGGGAGG + Intergenic
1061261223 9:129482162-129482184 CTGGGAGGGGAGAGGGGGGCGGG - Intergenic
1061373600 9:130211617-130211639 CAGGAAGGGGAGAGAGGGACCGG - Intronic
1061418115 9:130459002-130459024 CAGGAAGGGGAGAAGGGCCCTGG - Intronic
1061473179 9:130843709-130843731 CAGGAAGAGCAGAAGAGGCTGGG + Intronic
1061498406 9:130989001-130989023 CAGGAAGGGCAGGAGGTGGCTGG - Intergenic
1061507196 9:131038101-131038123 CAGGCAGAGGAAGAGGGGGCGGG - Intronic
1061834443 9:133319522-133319544 CAGTAAGAGGGAAAGGGGCCTGG + Intergenic
1061905111 9:133692694-133692716 CGGGAGGAGGTGAAGGAGGCCGG - Intronic
1061936606 9:133861195-133861217 CAGGAAGGGGTGTGGGGGGCGGG - Intronic
1061938612 9:133872220-133872242 AGGGAAGAGAAGAAAGGGGCAGG + Intronic
1062192170 9:135253633-135253655 CAGGAAGAGGAGCATGAGGGCGG - Intergenic
1062254586 9:135614943-135614965 CAGCAAGTGGGGAAGGGGACTGG + Intergenic
1062348644 9:136127873-136127895 GAGGAGGAGGAGGAGGAGGCTGG + Intergenic
1062449137 9:136608255-136608277 GAAGGAGAGGAGAAGGGGGAAGG + Intergenic
1062460566 9:136660991-136661013 CAGGTGGGGGAGGAGGGGGCAGG + Intronic
1062469704 9:136697007-136697029 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1062488102 9:136791197-136791219 CTGGAACAGGCGGAGGGGGCGGG - Intergenic
1062722263 9:138050613-138050635 CAGGAGGAGGGGAAGGGGTTGGG + Intronic
1203772640 EBV:57466-57488 GAGGAAGAGGAGAAGGAGCCCGG + Intergenic
1185459506 X:328272-328294 CGGGGAGAGGGGAGGGGGGCGGG - Intergenic
1185459783 X:328779-328801 CAGGGAGAGGGGAGGGGGGCGGG - Intergenic
1185499133 X:584281-584303 GAGGAGGAGGGGAAGGGGGAGGG + Intergenic
1185499161 X:584381-584403 GAGGAGGAGGGGAAGGGGGAGGG + Intergenic
1185520711 X:736491-736513 GGGGATGAGGAGATGGGGGCAGG - Intergenic
1186269185 X:7866466-7866488 AAGGGAGAGAGGAAGGGGGCAGG - Intergenic
1186471160 X:9823075-9823097 AAGGAGGAGGAGAAGGGAGAAGG - Intronic
1186604559 X:11076949-11076971 CAGGAAGAGTAGATGGGGGTGGG - Intergenic
1186689708 X:11962329-11962351 CAGGAAGAGCAGAAGGGAAAAGG + Intergenic
1186733866 X:12440386-12440408 TAGGAAGAGGAGAACAGGGAGGG + Intronic
1187000480 X:15171674-15171696 TAGGAAGAGGAGAACGGAGAAGG - Intergenic
1187515021 X:19961045-19961067 AAGGAAGAGGAGGAGGGAGGAGG - Intronic
1188156589 X:26749044-26749066 CAGGTGGAGGGCAAGGGGGCTGG - Intergenic
1188256457 X:27966986-27967008 GAGGAAGAAGAGGAGGGGGGGGG - Intergenic
1188285710 X:28323345-28323367 GAGGAAGGGGAGATGGGGGTGGG - Intergenic
1189084047 X:38001440-38001462 CAGGAAGGGTAGTAGGGTGCTGG - Intronic
1189110736 X:38286495-38286517 GAGGAAGAGGAGGAGGGTGAGGG - Exonic
1189489166 X:41456315-41456337 CAGGAAAAGGAGGAGAGGCCAGG + Intronic
1190054779 X:47175211-47175233 CAGGAAGGGGAGAGAGGGGGCGG - Intronic
1190123389 X:47682579-47682601 GAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1190291772 X:48997735-48997757 CAGGGAGAAGAGGAGGGGTCAGG + Intronic
1190641020 X:52482761-52482783 AAGGAAGAGGAAAAGGAGGAAGG - Intergenic
1190646652 X:52530104-52530126 AAGGAAGAGGAAAAGGAGGAAGG + Intergenic
1190712084 X:53078579-53078601 CAGGAAGAAGAGTTGGGGGCTGG - Exonic
1190881320 X:54494876-54494898 CAGACAGAGGAGAAGGGGGTTGG + Intronic
1190912926 X:54788802-54788824 CTGGGAGAGGAGCATGGGGCAGG - Intronic
1191676282 X:63795333-63795355 AAAGAAGAGGAGGAGGGGGAAGG + Intergenic
1191836655 X:65470386-65470408 AAGGGAGAGGAGATGGGGGCTGG + Intronic
1191842875 X:65525469-65525491 CAGGGAGAAGAGAAGGGGTAGGG - Intronic
1191954782 X:66632437-66632459 CAGGAGGAGGAGGAGGAGGAGGG + Intronic
1192161411 X:68790871-68790893 AAGGAAGAGGAGAAAGGGAGAGG - Intergenic
1192260630 X:69504331-69504353 CACGGAGAGGAGGAGGGAGCGGG - Intergenic
1193691478 X:84650320-84650342 TAGGAAGAATAGTAGGGGGCTGG - Intergenic
1194012544 X:88580848-88580870 GAGGGAGAGGGTAAGGGGGCTGG + Intergenic
1194014718 X:88605070-88605092 CAGGAGGAAGTTAAGGGGGCAGG + Intergenic
1194121906 X:89972841-89972863 GGGGTGGAGGAGAAGGGGGCAGG - Intergenic
1194566846 X:95499567-95499589 GAGGAAGAGGAGAAGGAGCGAGG - Intergenic
1195518530 X:105804952-105804974 GAGGAAGAAGAGAAGAGGGAGGG + Intergenic
1195649146 X:107266508-107266530 CAGGAAAAGTAGTAGGGGGAGGG - Intergenic
1195696231 X:107669609-107669631 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1195789650 X:108569526-108569548 AAGGAAAAGGAGAAAGGGGAGGG - Intronic
1195821342 X:108948098-108948120 GAGGAAGAGGGGAAGGAGGGAGG - Intergenic
1195973955 X:110505124-110505146 AAGGAAAAGGAAAAGGGGGAAGG - Intergenic
1196181102 X:112690491-112690513 GAGGAAGAGAAGAAGGAGGAGGG + Intergenic
1196900029 X:120373889-120373911 CAGGAGGAGGAGGCGGGGGAGGG - Intronic
1196923008 X:120603914-120603936 CAGGAAGAGAAGAATGGAGGGGG - Intronic
1197033670 X:121849244-121849266 CAGGAGGAGGAGGAAGGGGGAGG - Intergenic
1198301564 X:135338871-135338893 AAGAAAGAGGAAAAGGGGGAAGG - Intronic
1198435173 X:136609989-136610011 TAGAAAGAGGAGAATGGAGCAGG - Intergenic
1199263974 X:145808734-145808756 CAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1199284644 X:146042498-146042520 TAGAAAGAGGAGGTGGGGGCCGG + Intergenic
1199417307 X:147599952-147599974 CAGTAAGAGTAGCAGGAGGCTGG + Intergenic
1199599802 X:149535214-149535236 GAGGAAAAGGAGGAGGGGGTGGG - Intergenic
1199650838 X:149945038-149945060 GAGGAAAAGGAGGAGGGGGTTGG + Intergenic
1199672678 X:150160165-150160187 GAGGAGGAAGAGCAGGGGGCAGG - Intergenic
1199715752 X:150506336-150506358 AAGGAAGAGGAGGAGGAGGAAGG - Intronic
1199717757 X:150518460-150518482 CAGGAGGAATAGAAGGAGGCTGG + Intergenic
1199858541 X:151779560-151779582 AGGGAAAAGGAGATGGGGGCAGG + Intergenic
1200144725 X:153920717-153920739 CGGCAGGAGGAGAAGCGGGCAGG - Exonic
1200238903 X:154483471-154483493 CAGGTAGTGGAGGAGAGGGCTGG - Intergenic
1200397249 X:155998470-155998492 CAGGAAGAGAAAATGGGGGCAGG - Intronic
1201300269 Y:12498827-12498849 GAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1201474283 Y:14364080-14364102 AAGGAGGAGAAGAAAGGGGCAGG + Intergenic
1201588892 Y:15591859-15591881 AAGTAAGAGGGGAAGTGGGCAGG - Intergenic
1201739703 Y:17310939-17310961 AAGGAGGAGGAGAAGGGGGGAGG - Intergenic
1202270966 Y:23073652-23073674 CAGAAAGGGAAGAAGGGGGATGG + Intergenic
1202295060 Y:23347030-23347052 CAGAAAGGGAAGAAGGGGGATGG - Intergenic
1202423961 Y:24707396-24707418 CAGAAAGGGAAGAAGGGGGATGG + Intergenic
1202446828 Y:24962689-24962711 CAGAAAGGGAAGAAGGGGGATGG - Intergenic