ID: 1075048985

View in Genome Browser
Species Human (GRCh38)
Location 10:119168001-119168023
Sequence CATTCATTGCAGGAGTTACA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075048983_1075048985 23 Left 1075048983 10:119167955-119167977 CCACTTTTTAAAATAATACGATT 0: 1
1: 0
2: 3
3: 58
4: 677
Right 1075048985 10:119168001-119168023 CATTCATTGCAGGAGTTACACGG 0: 1
1: 0
2: 2
3: 8
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075048985 Original CRISPR CATTCATTGCAGGAGTTACA CGG Exonic
904219882 1:28958506-28958528 CATTATTTTCAGCAGTTACACGG - Intronic
912074858 1:105861315-105861337 CGTTCATTGCAGCATTTGCACGG + Intergenic
913656723 1:120967746-120967768 CAATCATTGCAGAAGTCAAAGGG + Intergenic
914007865 1:143749002-143749024 CAATCATTGCAGAAGTTGAAGGG + Intergenic
914521275 1:148418992-148419014 CAATCATTGCAGAAGTCAAAGGG + Intergenic
914646687 1:149659483-149659505 CAATCATTGCAGAAGTCAAAGGG + Intergenic
916311126 1:163400020-163400042 CTCACATTGCTGGAGTTACACGG - Intergenic
917088113 1:171324077-171324099 CAGTCATTGCATGAGGTCCAAGG + Intronic
917143650 1:171864180-171864202 CTTTCATTGCAGGGATTGCAAGG + Intronic
919521198 1:198590505-198590527 TATGCATTGCAGAAGTTTCAGGG - Intergenic
920333423 1:205228267-205228289 CAGTCATTGCAGGAGGGAGAAGG - Exonic
920934717 1:210420774-210420796 TATTCATTGCAGGTGGTTCAAGG - Intronic
923234799 1:232022080-232022102 CATACATTGAAGGAATTTCAAGG + Intronic
924144815 1:241062982-241063004 AATTCAGTGGAGGAGTAACATGG - Intronic
1063332043 10:5169369-5169391 GATTGATTGCAGGAGCAACACGG + Intergenic
1063434921 10:6021887-6021909 CACCCCTTGCAGGAGTGACAGGG - Intronic
1064586844 10:16847662-16847684 CATCCATTGCAGGAGTTAGTTGG - Intronic
1064866746 10:19889299-19889321 GATTAATAGCAGGAGTGACATGG - Intronic
1065288721 10:24209278-24209300 CATTCAAAGATGGAGTTACAGGG + Intronic
1069404690 10:68086480-68086502 CATTCATTCCTGGGGATACAAGG - Intergenic
1071367153 10:84910918-84910940 CATTTATTGCAGGAGTCTCAGGG + Intergenic
1073770407 10:106729091-106729113 CATTCATTGCTGGTGTTAGTAGG + Intronic
1073804247 10:107079309-107079331 CATTCTTTGGAAGAGTTCCATGG + Intronic
1075048985 10:119168001-119168023 CATTCATTGCAGGAGTTACACGG + Exonic
1075231127 10:120679407-120679429 CATTCATTCTAGGATTTATAAGG + Intergenic
1075953601 10:126503960-126503982 CATTCCTGGCTGGAGTTACAGGG - Exonic
1076200385 10:128553086-128553108 CATTCAGTGCAGCAGTTACGAGG - Intergenic
1079554171 11:21739218-21739240 CATTCATGGCAGAAGGTAAAGGG + Intergenic
1079863276 11:25701435-25701457 CATACATTGCAGCTGTTACTTGG - Intergenic
1080358291 11:31478562-31478584 CTTTAAATGCAGGAGTCACAGGG + Intronic
1085842619 11:80029919-80029941 CTTTAATTGCAGCAATTACAGGG - Intergenic
1086528382 11:87755476-87755498 CTTTCATGCCAGGAGTTACCAGG - Intergenic
1088413378 11:109562059-109562081 CCATTATTGCAGGAGTAACATGG + Intergenic
1090099885 11:123783080-123783102 CATTCACTGCTGCAGTTACCTGG - Intergenic
1090510492 11:127369572-127369594 CATTGATTGCAGGAGTTTCAAGG + Intergenic
1091194837 11:133721769-133721791 GACTCCTTCCAGGAGTTACAGGG + Intergenic
1094671570 12:32575330-32575352 CATTCATGGCAGAAGATAAAGGG + Intronic
1095725735 12:45450378-45450400 CATTAATTGCAGTTGTTTCAGGG - Intergenic
1097528569 12:60770006-60770028 CATTCATTGCAAAAGTTTGAAGG + Intergenic
1100057720 12:90533835-90533857 CATACATTGCATCAGTTGCATGG + Intergenic
1106497351 13:30292427-30292449 CTTCCTTTGCAGGTGTTACATGG - Intronic
1107179664 13:37444172-37444194 AAGTCATTGCAGGAGTTCAATGG - Intergenic
1107261011 13:38491148-38491170 CATTCATTTCTGGATTTACTTGG + Intergenic
1108246902 13:48525995-48526017 AATTCATTGACAGAGTTACATGG - Intronic
1111508823 13:89232783-89232805 CATTCATTCCAGGAGCTAAGAGG - Intergenic
1111867511 13:93787927-93787949 CATTCATTGCAGAAGTGAAATGG + Intronic
1112399141 13:99060569-99060591 CATACATTGCTGGTGTTAAATGG - Intronic
1114796011 14:25715562-25715584 CAGTCACTACAGGAGTTAGATGG + Intergenic
1118900603 14:69982451-69982473 CATCCATTGCTTGAGTGACAAGG - Intronic
1123138430 14:106051957-106051979 GAGTCATTGCTGGAGTCACAGGG + Intergenic
1123903568 15:24900106-24900128 CATTCAGTGCAGCAGTCACTCGG - Intronic
1126878041 15:53065261-53065283 GATTCATTACAGCAGTCACAGGG + Intergenic
1127097761 15:55530094-55530116 CATTCATGGCAGGAATATCATGG + Intergenic
1129062056 15:72868034-72868056 CATTCCTTGCTGGAGGTTCAAGG + Intergenic
1135296878 16:21287400-21287422 CATTCATTCCAGAAATTCCAAGG - Intronic
1137725824 16:50655935-50655957 CATTGGTTGCAGGACTCACAGGG + Intergenic
1138256920 16:55573286-55573308 AATTCTTTGCTGGAGTTTCATGG - Intronic
1140270339 16:73459727-73459749 CAATCATGGCAGGAGATAAAGGG + Intergenic
1143251105 17:5523699-5523721 CTTGCATTGCAGCAGTTACCAGG - Intronic
1143308635 17:5969997-5970019 CAATCATGGCAGAAGGTACAGGG - Intronic
1147550695 17:41439360-41439382 CTTTCATCACAGGAGGTACAGGG + Intronic
1151780809 17:76243961-76243983 TAATCATTGCATGTGTTACAAGG - Intergenic
1152189970 17:78882446-78882468 CATTTATTACAGCAGTTGCAGGG - Intronic
1155714475 18:28924005-28924027 CATTCATTGTATGAGTTATTTGG - Intergenic
1157736852 18:50057369-50057391 CATTCCTGGCATGATTTACATGG - Intronic
1159381380 18:67664132-67664154 CATTCATTGCAGAACTTCCTTGG + Intergenic
1161577210 19:5060961-5060983 CTTTAATTGCAGGCGTGACATGG + Intronic
1161773555 19:6244302-6244324 CATTCTTTGCTGGAGTTTCATGG - Intronic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
926045993 2:9710022-9710044 CATGCAATCCAGGAGTTGCAGGG - Intergenic
926672246 2:15587422-15587444 CTTACATGGCAGGAGGTACAAGG - Intergenic
926728447 2:16016115-16016137 CATTCACTGCAGGTCTTGCATGG + Intergenic
928397334 2:30953116-30953138 CATTCATGCCTGGAGTTAAAAGG - Intronic
929830427 2:45342686-45342708 CTGTCATTGTAGGAGTCACAAGG + Intergenic
931191330 2:60003159-60003181 AATTCATTTAAGGAGTTAAAAGG + Intergenic
931570737 2:63666836-63666858 CATTCATTGCTGGAGAATCAAGG + Intronic
934082678 2:88482974-88482996 CATTCCTTCCAGAAGTTTCAGGG + Intergenic
934086784 2:88516526-88516548 CCTTCAGTGCTGGACTTACATGG - Intergenic
943526535 2:189023360-189023382 CATTTCTTGCATGAGTTAGATGG - Intergenic
943644902 2:190399776-190399798 CATTCATTAGAGAAGTTGCAAGG - Intergenic
944772250 2:202926079-202926101 CATTCATTGCAGGACATCAAAGG - Intronic
947377444 2:229510805-229510827 CATTCATTTGAACAGTTACATGG - Intronic
1169574279 20:6941046-6941068 CAGCCATTTCAGGAGTTACTGGG + Intergenic
1173450726 20:43161379-43161401 CATTCATTAAAGAAGTTATACGG + Intronic
1173618325 20:44417384-44417406 CATTCTCTGCAGGGGGTACAAGG - Intronic
1175195083 20:57237514-57237536 CATTCATTCAAAGATTTACATGG + Intronic
1175717836 20:61267207-61267229 CATTTATTACAGCAGTCACAGGG + Intronic
1177930102 21:27270743-27270765 CATTCATTGCACTTTTTACAAGG - Intergenic
949398104 3:3636602-3636624 AATACATTGCAGCATTTACATGG + Intergenic
950481064 3:13244103-13244125 CAGACATTGCAGGAGTCAGACGG - Intergenic
955720293 3:61873297-61873319 CATTCATTTTAGCAGTTGCATGG - Intronic
957869784 3:86076490-86076512 AATTCATAGCAAGAGGTACAAGG - Intergenic
957929895 3:86863987-86864009 GAATCATTGCAGGAGGTAGAAGG - Intergenic
961941518 3:130642435-130642457 CTTTCATAGCAGAAGTTTCAAGG - Intronic
965073595 3:163947808-163947830 CATTCATTGCAAAAGTTACTTGG - Intergenic
965629033 3:170711607-170711629 CATTCATGGCAGAAGGTAAAGGG - Intronic
966129533 3:176621718-176621740 CAATGAGTGCAGGAGGTACATGG + Intergenic
969116529 4:4873784-4873806 CCTTCATTCCAGGAGGAACAGGG + Intergenic
974121966 4:57649663-57649685 CATTCATGGCAGGAGGTGGAAGG + Intergenic
977393819 4:96447704-96447726 CAATCATGGCAGAAGTTAAAAGG - Intergenic
981055554 4:140357507-140357529 CATTCACTGCAGGAGGTGCCAGG - Intronic
981358370 4:143818987-143819009 GATTCATTTCAGGAGTAATAGGG - Intergenic
987042220 5:14073579-14073601 CATGCTTTCCAGGAGTTGCAAGG + Intergenic
990620923 5:57557599-57557621 CAATCATGGCAGGAGGTAAAAGG - Intergenic
991549899 5:67824510-67824532 CATTCATTGCAGAAGGTAAAGGG - Intergenic
993107584 5:83616937-83616959 CATACTTTGCAGGACTTAGATGG + Intergenic
993854471 5:93056347-93056369 CAATCATGGCAGAAGGTACAAGG + Intergenic
994431848 5:99676023-99676045 CACTCATGGCAGAAGGTACAGGG + Intergenic
994734992 5:103541899-103541921 ACTTCATTGAAAGAGTTACAGGG - Intergenic
995640290 5:114248975-114248997 CATTCATTGCAGTTTTTACCAGG - Intergenic
995911508 5:117193246-117193268 CATTCATGGCAGAAGGTAAAGGG - Intergenic
996110668 5:119562797-119562819 CAGTCATTTCAGCAGCTACAAGG - Intronic
1000907474 5:166979764-166979786 CATTAGTTGCATGAGTTTCAGGG + Intergenic
1005280907 6:24272474-24272496 CATTGATTCCAGAATTTACAAGG + Intronic
1008975714 6:57423845-57423867 CAGTCAGTGCAGGAGTTTTAAGG + Intronic
1010012877 6:71069428-71069450 CATTTATTCCAGGAGACACACGG - Intergenic
1014397579 6:120945087-120945109 CAATCATTGCAGAAGGTAAAGGG + Intergenic
1016360890 6:143266382-143266404 CATTCATTGCAGGTGTTAAATGG + Intronic
1017468406 6:154716489-154716511 CATTCATGGCAGAAGGCACAGGG + Intergenic
1017531782 6:155299988-155300010 CATGCATTGCTGTAGCTACAGGG - Intronic
1017713216 6:157188279-157188301 CATTCAGTGCAGGGCTCACAGGG + Intronic
1018027295 6:159816258-159816280 CATTTGGGGCAGGAGTTACATGG - Intronic
1018722961 6:166587830-166587852 CATTCATGGCAGGACTTTCCGGG + Intronic
1020205783 7:6114275-6114297 CATCCATGGCAGATGTTACAAGG + Intronic
1020789335 7:12606393-12606415 AATTTAATGCAGTAGTTACATGG + Intronic
1021973274 7:25985444-25985466 CAGTCATGGCAGGAGCTGCAGGG - Intergenic
1023227196 7:37983324-37983346 CATACCTTGCAGGAGTCACCTGG + Intronic
1023629893 7:42153686-42153708 CATTCAATATAGAAGTTACAAGG - Intronic
1023903308 7:44502007-44502029 AATTCATTGGTGGGGTTACATGG - Intergenic
1030870186 7:114746233-114746255 CATCCATTGCAGTATTTACCTGG + Intergenic
1032892079 7:136208025-136208047 CATTAATTGCAGTAGTGAGAAGG - Intergenic
1040655322 8:49500831-49500853 CAATCATGGCAGGAGGTAAAGGG - Intergenic
1046185751 8:110714190-110714212 CAATCATGGCAGAAGGTACAGGG - Intergenic
1046933105 8:119860614-119860636 CATTCATCACAGCAGTTGCAGGG - Intergenic
1047483016 8:125302379-125302401 CACACATTCCAGGAGTGACAAGG + Intronic
1048462138 8:134629697-134629719 CAATCATTGCAGAAGTTGAAGGG - Intronic
1051130783 9:13857823-13857845 CATTCATTACAGAAATAACAAGG - Intergenic
1052103525 9:24481174-24481196 CAATCATGGCAGGAGATAAAAGG - Intergenic
1056162508 9:83910874-83910896 CATTATTTACAGGAGCTACAAGG + Intronic
1056357839 9:85820653-85820675 CATTATTTACAGGAGCTACAAGG - Intergenic
1056766029 9:89445259-89445281 CATTCAGTGCATGGGTTTCAGGG - Intronic
1185907822 X:3953040-3953062 CATTCATGGCAGCAGCTCCACGG - Intergenic
1188651424 X:32635198-32635220 CATCCATGGCAGCAGTCACATGG - Intronic
1188912975 X:35872999-35873021 CAATCATTGCAGAAGTCAAAGGG - Intergenic
1189068957 X:37844469-37844491 CTATCATAGTAGGAGTTACATGG - Intronic
1189589196 X:42493950-42493972 CAATCATGGCAGGAGGTAAAGGG - Intergenic
1190443011 X:50494639-50494661 CAATCATGGCAGAAGTTAAAGGG - Intergenic
1196611943 X:117725498-117725520 CTTACCTTGCAGGAGTTTCAAGG - Intergenic
1197288424 X:124624733-124624755 CTCTCACTGCAGGAGTTATAAGG + Intronic
1198794278 X:140379098-140379120 CATTAATTGCAGTATATACAAGG + Intergenic
1199564731 X:149203531-149203553 CATTCAGTGCAGGAGCAAAAAGG + Intergenic