ID: 1075052259

View in Genome Browser
Species Human (GRCh38)
Location 10:119191514-119191536
Sequence CTCTTCAATGAGGGAAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075052259_1075052265 3 Left 1075052259 10:119191514-119191536 CCTTTTTTTCCCTCATTGAAGAG No data
Right 1075052265 10:119191540-119191562 CCCCAGATTTGGCTCTCTCCTGG No data
1075052259_1075052263 -8 Left 1075052259 10:119191514-119191536 CCTTTTTTTCCCTCATTGAAGAG No data
Right 1075052263 10:119191529-119191551 TTGAAGAGGAGCCCCAGATTTGG No data
1075052259_1075052270 26 Left 1075052259 10:119191514-119191536 CCTTTTTTTCCCTCATTGAAGAG No data
Right 1075052270 10:119191563-119191585 GTTCAGAAAAGATGAAGTCTCGG No data
1075052259_1075052267 4 Left 1075052259 10:119191514-119191536 CCTTTTTTTCCCTCATTGAAGAG No data
Right 1075052267 10:119191541-119191563 CCCAGATTTGGCTCTCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075052259 Original CRISPR CTCTTCAATGAGGGAAAAAA AGG (reversed) Intergenic
No off target data available for this crispr