ID: 1075052262

View in Genome Browser
Species Human (GRCh38)
Location 10:119191524-119191546
Sequence TCTGGGGCTCCTCTTCAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075052262_1075052267 -6 Left 1075052262 10:119191524-119191546 CCTCATTGAAGAGGAGCCCCAGA No data
Right 1075052267 10:119191541-119191563 CCCAGATTTGGCTCTCTCCTGGG No data
1075052262_1075052270 16 Left 1075052262 10:119191524-119191546 CCTCATTGAAGAGGAGCCCCAGA No data
Right 1075052270 10:119191563-119191585 GTTCAGAAAAGATGAAGTCTCGG No data
1075052262_1075052265 -7 Left 1075052262 10:119191524-119191546 CCTCATTGAAGAGGAGCCCCAGA No data
Right 1075052265 10:119191540-119191562 CCCCAGATTTGGCTCTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075052262 Original CRISPR TCTGGGGCTCCTCTTCAATG AGG (reversed) Intergenic
No off target data available for this crispr