ID: 1075052264

View in Genome Browser
Species Human (GRCh38)
Location 10:119191540-119191562
Sequence CCAGGAGAGAGCCAAATCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075052264_1075052270 0 Left 1075052264 10:119191540-119191562 CCCCAGATTTGGCTCTCTCCTGG No data
Right 1075052270 10:119191563-119191585 GTTCAGAAAAGATGAAGTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075052264 Original CRISPR CCAGGAGAGAGCCAAATCTG GGG (reversed) Intergenic