ID: 1075052265

View in Genome Browser
Species Human (GRCh38)
Location 10:119191540-119191562
Sequence CCCCAGATTTGGCTCTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075052261_1075052265 -6 Left 1075052261 10:119191523-119191545 CCCTCATTGAAGAGGAGCCCCAG No data
Right 1075052265 10:119191540-119191562 CCCCAGATTTGGCTCTCTCCTGG No data
1075052259_1075052265 3 Left 1075052259 10:119191514-119191536 CCTTTTTTTCCCTCATTGAAGAG No data
Right 1075052265 10:119191540-119191562 CCCCAGATTTGGCTCTCTCCTGG No data
1075052262_1075052265 -7 Left 1075052262 10:119191524-119191546 CCTCATTGAAGAGGAGCCCCAGA No data
Right 1075052265 10:119191540-119191562 CCCCAGATTTGGCTCTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075052265 Original CRISPR CCCCAGATTTGGCTCTCTCC TGG Intergenic
No off target data available for this crispr