ID: 1075052268

View in Genome Browser
Species Human (GRCh38)
Location 10:119191542-119191564
Sequence ACCCAGGAGAGAGCCAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075052268_1075052270 -2 Left 1075052268 10:119191542-119191564 CCAGATTTGGCTCTCTCCTGGGT No data
Right 1075052270 10:119191563-119191585 GTTCAGAAAAGATGAAGTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075052268 Original CRISPR ACCCAGGAGAGAGCCAAATC TGG (reversed) Intergenic
No off target data available for this crispr