ID: 1075052270

View in Genome Browser
Species Human (GRCh38)
Location 10:119191563-119191585
Sequence GTTCAGAAAAGATGAAGTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075052264_1075052270 0 Left 1075052264 10:119191540-119191562 CCCCAGATTTGGCTCTCTCCTGG No data
Right 1075052270 10:119191563-119191585 GTTCAGAAAAGATGAAGTCTCGG No data
1075052261_1075052270 17 Left 1075052261 10:119191523-119191545 CCCTCATTGAAGAGGAGCCCCAG No data
Right 1075052270 10:119191563-119191585 GTTCAGAAAAGATGAAGTCTCGG No data
1075052262_1075052270 16 Left 1075052262 10:119191524-119191546 CCTCATTGAAGAGGAGCCCCAGA No data
Right 1075052270 10:119191563-119191585 GTTCAGAAAAGATGAAGTCTCGG No data
1075052266_1075052270 -1 Left 1075052266 10:119191541-119191563 CCCAGATTTGGCTCTCTCCTGGG No data
Right 1075052270 10:119191563-119191585 GTTCAGAAAAGATGAAGTCTCGG No data
1075052268_1075052270 -2 Left 1075052268 10:119191542-119191564 CCAGATTTGGCTCTCTCCTGGGT No data
Right 1075052270 10:119191563-119191585 GTTCAGAAAAGATGAAGTCTCGG No data
1075052259_1075052270 26 Left 1075052259 10:119191514-119191536 CCTTTTTTTCCCTCATTGAAGAG No data
Right 1075052270 10:119191563-119191585 GTTCAGAAAAGATGAAGTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075052270 Original CRISPR GTTCAGAAAAGATGAAGTCT CGG Intergenic
No off target data available for this crispr