ID: 1075053961

View in Genome Browser
Species Human (GRCh38)
Location 10:119204551-119204573
Sequence CACAATATCCAGATGAGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075053961_1075053968 28 Left 1075053961 10:119204551-119204573 CCCTACCTCATCTGGATATTGTG No data
Right 1075053968 10:119204602-119204624 ACAAGAGCCTGGCCCACAGTTGG No data
1075053961_1075053966 17 Left 1075053961 10:119204551-119204573 CCCTACCTCATCTGGATATTGTG No data
Right 1075053966 10:119204591-119204613 TTTAAAAGACCACAAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075053961 Original CRISPR CACAATATCCAGATGAGGTA GGG (reversed) Intergenic
No off target data available for this crispr