ID: 1075054499

View in Genome Browser
Species Human (GRCh38)
Location 10:119207525-119207547
Sequence GGTGTGGTACTAGCAGGCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 102}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075054499_1075054508 -5 Left 1075054499 10:119207525-119207547 CCCGAGCCTGCTAGTACCACACC 0: 1
1: 0
2: 0
3: 2
4: 102
Right 1075054508 10:119207543-119207565 ACACCCCCGGGAGGGACTGAGGG 0: 1
1: 0
2: 0
3: 18
4: 136
1075054499_1075054512 -1 Left 1075054499 10:119207525-119207547 CCCGAGCCTGCTAGTACCACACC 0: 1
1: 0
2: 0
3: 2
4: 102
Right 1075054512 10:119207547-119207569 CCCCGGGAGGGACTGAGGGGAGG 0: 1
1: 0
2: 2
3: 32
4: 402
1075054499_1075054507 -6 Left 1075054499 10:119207525-119207547 CCCGAGCCTGCTAGTACCACACC 0: 1
1: 0
2: 0
3: 2
4: 102
Right 1075054507 10:119207542-119207564 CACACCCCCGGGAGGGACTGAGG 0: 1
1: 0
2: 2
3: 16
4: 190
1075054499_1075054515 14 Left 1075054499 10:119207525-119207547 CCCGAGCCTGCTAGTACCACACC 0: 1
1: 0
2: 0
3: 2
4: 102
Right 1075054515 10:119207562-119207584 AGGGGAGGCAGAAGCATCCGAGG 0: 1
1: 0
2: 3
3: 22
4: 310
1075054499_1075054509 -4 Left 1075054499 10:119207525-119207547 CCCGAGCCTGCTAGTACCACACC 0: 1
1: 0
2: 0
3: 2
4: 102
Right 1075054509 10:119207544-119207566 CACCCCCGGGAGGGACTGAGGGG 0: 1
1: 0
2: 1
3: 12
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075054499 Original CRISPR GGTGTGGTACTAGCAGGCTC GGG (reversed) Intergenic
900933891 1:5753465-5753487 GGTGTGATCAGAGCAGGCTCAGG - Intergenic
903133764 1:21295969-21295991 GGTGTGGTTCACGCAGGCTTGGG - Intronic
909900679 1:81130863-81130885 AGTGTGATAAAAGCAGGCTCTGG - Intergenic
910379177 1:86608267-86608289 GGAGTGGTTATAGCAGGCCCTGG - Intergenic
912887340 1:113488874-113488896 GGTGGGGTACTGGCAGGTGCAGG - Intronic
917512170 1:175677674-175677696 GTTGTGGCAATGGCAGGCTCAGG + Intronic
918440423 1:184561167-184561189 GCTGTGGCACTGGCAGGCTTAGG - Intronic
920390315 1:205596171-205596193 GCTGTGCTACTAACAGGCACTGG + Intronic
1062904968 10:1173694-1173716 GGTGTGGTGGTAGCAGCCTGTGG - Intergenic
1065226429 10:23548321-23548343 GATGTGCCACTAGCAGGGTCTGG - Intergenic
1069885967 10:71623859-71623881 GGTGTGGTAGTGGAAGGCTGAGG - Intronic
1071293812 10:84205100-84205122 ACTGTGGAGCTAGCAGGCTCAGG - Intronic
1073355891 10:102853945-102853967 GGTCTGGAACTCTCAGGCTCAGG + Intergenic
1074820243 10:117173128-117173150 GGTCTGGAACTAACAGCCTCAGG + Intergenic
1075054499 10:119207525-119207547 GGTGTGGTACTAGCAGGCTCGGG - Intergenic
1076646185 10:131956437-131956459 GATGTGGCCCGAGCAGGCTCAGG + Exonic
1076788827 10:132765609-132765631 TCTGTGGTGCCAGCAGGCTCTGG - Intronic
1077226945 11:1442737-1442759 TGTGGGGTACTGGGAGGCTCAGG - Intronic
1083411053 11:62492650-62492672 GGTGTGGGACTCCTAGGCTCAGG - Intronic
1087154409 11:94886495-94886517 TGTCTGTTACTGGCAGGCTCAGG + Intergenic
1087523820 11:99281508-99281530 GGTGTTGCACAAGCAGGGTCAGG - Intronic
1096841825 12:54384621-54384643 GGAGTGGGACTGGCAGGCTTGGG - Intronic
1099635486 12:85206269-85206291 GGTGGGGTGCTGGCAGGCACTGG + Intronic
1102925698 12:116824474-116824496 GGTGTCATACTCCCAGGCTCGGG - Intronic
1103050272 12:117773183-117773205 GGTGTGGTAGCAGGGGGCTCTGG + Intronic
1112332819 13:98489703-98489725 GGTGTGTTTCTCACAGGCTCAGG + Intronic
1116431752 14:44854248-44854270 GGTGGGGTGCTGGCAGGCACAGG - Intergenic
1120793596 14:88607812-88607834 GGGATGGTACTTGCAGGCTGAGG - Intronic
1120793603 14:88607838-88607860 GGGATGGTACTTGCAGGCTGAGG - Intronic
1121419406 14:93802090-93802112 GGTGTGGGACCAGAAGACTCAGG + Intergenic
1126315036 15:47361152-47361174 AGTGTGGAACTGACAGGCTCTGG - Intronic
1127846668 15:62876748-62876770 GGGGTGGTCCTACCAGGCACAGG + Intergenic
1132522272 16:397285-397307 CGTGGCGCACTAGCAGGCTCGGG - Exonic
1133987551 16:10680047-10680069 GGTGTGGAAATTGGAGGCTCTGG + Intronic
1135800356 16:25488749-25488771 GGTGGGGTGCTGGCAGGCACGGG + Intergenic
1139587591 16:67914100-67914122 GTTGTCCTAATAGCAGGCTCTGG + Intronic
1142026794 16:87818712-87818734 GATGGGGAACCAGCAGGCTCAGG + Intergenic
1142468382 17:148482-148504 GGTGTGGGGAGAGCAGGCTCAGG - Intronic
1148466675 17:47869124-47869146 GGAGTGGCACTGCCAGGCTCTGG - Intergenic
1152462877 17:80450498-80450520 GTTGTGCTCCTGGCAGGCTCGGG + Intergenic
1152945988 17:83197508-83197530 GGTGTGGGATCTGCAGGCTCAGG + Intergenic
1155100593 18:22606748-22606770 AGTGGAGTACTAGCAGGCTGTGG - Intergenic
1155524436 18:26702185-26702207 ACTGTGGCACTAGCAGACTCCGG - Intergenic
1159798563 18:72869508-72869530 GGTGTGGTGGTAGGAGGCTTGGG - Intergenic
1163796411 19:19340804-19340826 GGTCAGGTCCTAGCAGGCCCAGG - Intronic
1164509913 19:28888737-28888759 GGTGTGGGACCTGCAGCCTCAGG + Intergenic
1164542615 19:29132148-29132170 GTTGTGGACTTAGCAGGCTCAGG + Intergenic
929755027 2:44757236-44757258 AGTGTGGCCCTAACAGGCTCTGG + Intronic
932806204 2:74785582-74785604 GGTGTGGAATTAGGAGGCCCTGG - Intergenic
933715337 2:85355665-85355687 GGTATGGTAATAGCAATCTCAGG - Intronic
934695625 2:96397978-96398000 TGTGTGGTTCAAGCAGGCCCAGG - Intergenic
935576401 2:104716199-104716221 GGAGTGGTTACAGCAGGCTCTGG + Intergenic
936561246 2:113541630-113541652 GGGGTCGGGCTAGCAGGCTCTGG + Intergenic
937448155 2:121975879-121975901 GGTGTTGTAACATCAGGCTCTGG + Intergenic
938717457 2:134033912-134033934 GCTGTGGAACTAGTGGGCTCTGG + Intergenic
947629471 2:231642756-231642778 GGTTGTGCACTAGCAGGCTCTGG + Intergenic
948464973 2:238147969-238147991 GGCGTTGTACTTGCAGGCGCTGG - Exonic
1176098218 20:63353725-63353747 GCTGTGGTCCTAGGAGGCTGTGG + Intronic
1177516500 21:22158580-22158602 GCTGTGGCTCAAGCAGGCTCAGG - Intergenic
1179840116 21:44067096-44067118 CGTGTGGGCCTAGCAGGGTCAGG + Intronic
1180176650 21:46093786-46093808 GGTGTGGGAGCTGCAGGCTCTGG + Intergenic
1180884200 22:19228353-19228375 GGTGAGGTGCCAGCAGGCTCTGG - Intronic
1181461655 22:23089386-23089408 GGTGTGGTCCTGGCGAGCTCAGG + Intronic
1184088467 22:42280013-42280035 GGTGAGTTACTAGCAGGGACAGG + Intronic
961187432 3:124927873-124927895 GCTGTGGTGCTAGCAGTTTCAGG + Exonic
961431788 3:126889011-126889033 CGTGTGGTGCTAGGAGCCTCAGG + Intronic
961567900 3:127776556-127776578 GGTGTGGCACCTCCAGGCTCAGG - Intronic
962630325 3:137269357-137269379 GGTGTGGTGCTACCATGATCAGG - Intergenic
964014765 3:151931101-151931123 GGTCTGGCACTGGCAGGCTTTGG + Intergenic
964083460 3:152788331-152788353 GGTGTGGGAATTGGAGGCTCTGG - Intergenic
964486181 3:157187048-157187070 GGTGGGGTACTGGTAGGCTTGGG - Intergenic
966890631 3:184405209-184405231 GTGGTGGTACCAGCAGCCTCAGG + Intronic
969990599 4:11258539-11258561 GGTGTGGTATTGGGAGGCTGAGG + Intergenic
972899703 4:43668524-43668546 CCTGTGGAACTACCAGGCTCTGG + Intergenic
975022268 4:69503569-69503591 GGTGGGGGACTGGCAGGGTCAGG - Intronic
980456141 4:133046234-133046256 AGTGGGGTGCTGGCAGGCTCAGG - Intergenic
980993260 4:139757307-139757329 GGGGGAGTACTGGCAGGCTCAGG - Intronic
996498885 5:124194081-124194103 GGTGTGGTTATAGAAGGGTCTGG - Intergenic
996954211 5:129164105-129164127 GGTGGGGCACTAGCAGGGGCAGG + Intergenic
997205944 5:132050275-132050297 TGTGTGGTCCCAGCAGGCTGGGG - Intergenic
997236106 5:132272723-132272745 GGTGGGGTGCTGGCAGCCTCAGG + Exonic
998758431 5:145405993-145406015 TGTGTGGTACCAGCTGGCTGTGG - Intergenic
1001871468 5:175159737-175159759 AGTCTGGGACTAGGAGGCTCTGG + Intergenic
1003894239 6:10591666-10591688 GGAGTGGTACTAGCAGGAGGAGG - Intronic
1004510707 6:16282028-16282050 GGTGGGTTTCTAGCAGGTTCAGG - Intronic
1010821291 6:80418934-80418956 GGTGTGGCACTGGCAGGTGCAGG + Intergenic
1014042082 6:116839816-116839838 GGTGAGGTAGGAGAAGGCTCAGG + Intergenic
1017047989 6:150365021-150365043 GGTGTGGCACTGACGGGCTCTGG + Intergenic
1018043434 6:159945219-159945241 GCTGTGGCTCAAGCAGGCTCAGG + Intergenic
1034363577 7:150524194-150524216 GGTGCAGCTCTAGCAGGCTCTGG - Intergenic
1034954759 7:155327602-155327624 GGTGTGGTAAGGGCAGGGTCAGG - Intergenic
1035989610 8:4474734-4474756 GGTGTGGTATTTGCTGTCTCCGG - Intronic
1037219861 8:16505218-16505240 GGTGATGTACTAGGTGGCTCTGG - Intronic
1038117481 8:24573717-24573739 GGTGTAGTCCTAGCAGAGTCTGG - Intergenic
1041358603 8:57026233-57026255 GTTGTGGTACAACCAGTCTCTGG - Intergenic
1041456437 8:58066091-58066113 GGCGGGGTACTACGAGGCTCTGG - Intronic
1043532016 8:81161442-81161464 GGAGGGGTACTAGGTGGCTCAGG + Intergenic
1047528440 8:125654097-125654119 GAGGTGATACTAGGAGGCTCTGG + Intergenic
1049463468 8:142740535-142740557 TGTGTGGTACCAGCAGGCCCAGG + Intergenic
1054871480 9:70051001-70051023 GCTGAGGCACTAGCAGGCTGGGG - Intronic
1060682018 9:125574735-125574757 GTTGTGGTAGTAGCTGGCTGCGG + Intronic
1062043088 9:134412955-134412977 GGTGTGGAAACAGCAGGGTCTGG + Intronic
1188734774 X:33699567-33699589 GGTGTGGTATTTGCATGTTCAGG - Intergenic
1188852083 X:35144396-35144418 GATGTGGTATTTGCAGGATCTGG - Intergenic
1195523165 X:105853804-105853826 GGTGTGGGAGTAGAAGACTCAGG - Intronic