ID: 1075055438

View in Genome Browser
Species Human (GRCh38)
Location 10:119214988-119215010
Sequence CTGCAGTTCTGGAGTGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075055427_1075055438 24 Left 1075055427 10:119214941-119214963 CCAGGCAGAGCAGGTGTTCAGGG 0: 1
1: 0
2: 13
3: 40
4: 354
Right 1075055438 10:119214988-119215010 CTGCAGTTCTGGAGTGAAGACGG No data
1075055436_1075055438 -5 Left 1075055436 10:119214970-119214992 CCTGGGCGGGTAGACGGGCTGCA 0: 1
1: 0
2: 0
3: 15
4: 156
Right 1075055438 10:119214988-119215010 CTGCAGTTCTGGAGTGAAGACGG No data
1075055425_1075055438 28 Left 1075055425 10:119214937-119214959 CCTTCCAGGCAGAGCAGGTGTTC 0: 1
1: 0
2: 2
3: 26
4: 233
Right 1075055438 10:119214988-119215010 CTGCAGTTCTGGAGTGAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075055438 Original CRISPR CTGCAGTTCTGGAGTGAAGA CGG Intronic
No off target data available for this crispr