ID: 1075056329

View in Genome Browser
Species Human (GRCh38)
Location 10:119221385-119221407
Sequence CTATAAACACAGATATGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 320}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075056329_1075056331 -8 Left 1075056329 10:119221385-119221407 CCTTTCCATATCTGTGTTTATAG 0: 1
1: 0
2: 2
3: 21
4: 320
Right 1075056331 10:119221400-119221422 GTTTATAGTTTCCCATGAAATGG No data
1075056329_1075056337 25 Left 1075056329 10:119221385-119221407 CCTTTCCATATCTGTGTTTATAG 0: 1
1: 0
2: 2
3: 21
4: 320
Right 1075056337 10:119221433-119221455 GGAAAAATTGTGAAAGACTTTGG No data
1075056329_1075056333 -3 Left 1075056329 10:119221385-119221407 CCTTTCCATATCTGTGTTTATAG 0: 1
1: 0
2: 2
3: 21
4: 320
Right 1075056333 10:119221405-119221427 TAGTTTCCCATGAAATGGATGGG No data
1075056329_1075056332 -4 Left 1075056329 10:119221385-119221407 CCTTTCCATATCTGTGTTTATAG 0: 1
1: 0
2: 2
3: 21
4: 320
Right 1075056332 10:119221404-119221426 ATAGTTTCCCATGAAATGGATGG No data
1075056329_1075056336 4 Left 1075056329 10:119221385-119221407 CCTTTCCATATCTGTGTTTATAG 0: 1
1: 0
2: 2
3: 21
4: 320
Right 1075056336 10:119221412-119221434 CCATGAAATGGATGGGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075056329 Original CRISPR CTATAAACACAGATATGGAA AGG (reversed) Intronic
900113028 1:1016964-1016986 CTATAAATACAGACAGGGCACGG - Intergenic
901037562 1:6345463-6345485 CTGTAAACACAGATAATAAATGG + Intronic
903270334 1:22184355-22184377 ATATAAACACACAGATGGACAGG + Intergenic
906867453 1:49438007-49438029 CCATAAAAACAGATACAGAAAGG + Intronic
907715114 1:56919386-56919408 CAATATACACAGTAATGGAAAGG - Intergenic
907925305 1:58950393-58950415 CTATAGACACAGGTGTGTAAGGG + Intergenic
909208188 1:72788554-72788576 ATATAAACACAAATCTGTAAAGG + Intergenic
910294653 1:85632325-85632347 CTAAGAAGACAGAAATGGAAAGG + Intergenic
910909610 1:92219142-92219164 CTATGAATACATATATGCAAAGG - Intronic
914199626 1:145473364-145473386 CCAGAAACACACATATGGTATGG - Intergenic
914478741 1:148046497-148046519 CCAGAAACACACATATGGTATGG - Intergenic
916098735 1:161374884-161374906 CTATAATCCCAGCTATGGAGGGG - Exonic
916822421 1:168412391-168412413 CTTTCAGCACAGACATGGAAAGG - Intergenic
917246012 1:173001498-173001520 CTGTAAACACAGAAATTCAAAGG - Intergenic
921811544 1:219520095-219520117 TGATAAACACAGAAAGGGAACGG - Intergenic
922249527 1:223835761-223835783 CTAGAAACACAAAGATGAAAAGG + Intronic
922625527 1:227037439-227037461 CTTTAAACACACATATCTAATGG + Intronic
923152722 1:231248037-231248059 ATATAAACACAGACATGTATGGG - Intronic
923417878 1:233782227-233782249 ATCTAAACACAGACATGGTACGG + Intergenic
923891730 1:238223157-238223179 CTATAAGCCCAGCTATAGAAAGG - Intergenic
924320626 1:242844983-242845005 CAATAAATAAAGAAATGGAATGG - Intergenic
924889906 1:248264528-248264550 CTTTAAAGATACATATGGAATGG - Intergenic
1063089145 10:2846140-2846162 CTAGAAACACGGAAATGGAGTGG - Intergenic
1063269403 10:4489490-4489512 CTGTAAACACACAAATGGAGGGG + Intergenic
1063481804 10:6382937-6382959 ATATAAACACAGGTGTGGGAGGG + Intergenic
1064941062 10:20736016-20736038 CTATATTCACATATATAGAAAGG + Intergenic
1066291316 10:34016868-34016890 CAATAAAAATAGAAATGGAATGG - Intergenic
1067986105 10:51147515-51147537 CTAAAAACAATGATGTGGAAAGG - Intronic
1068076087 10:52256673-52256695 CTATAAGCATAGAAAAGGAAGGG + Intronic
1068118209 10:52757891-52757913 CTTGAACCACAGATAGGGAATGG - Intergenic
1068778394 10:60892390-60892412 ATACAAACACACATATTGAAGGG - Intronic
1068988657 10:63129675-63129697 CTATAAAGAAAGAAATAGAAGGG - Intergenic
1069853054 10:71423002-71423024 ATATAAAAACATAAATGGAAGGG - Intronic
1070871494 10:79757894-79757916 ATATAAAAACAAAGATGGAATGG + Intergenic
1070935795 10:80294090-80294112 CTGTGAACACAGAAATGGAGGGG - Intergenic
1071142954 10:82534115-82534137 CGAGACACACAGAAATGGAAAGG + Intronic
1071415635 10:85438408-85438430 CTATAGTCACAGATATAGTAAGG - Intergenic
1071638426 10:87280102-87280124 ATATAAAAACAAAGATGGAATGG + Intergenic
1071656816 10:87457850-87457872 ATATAAAAACAAAGATGGAATGG - Intergenic
1072747687 10:97952899-97952921 ATATATTCACAGATGTGGAAGGG - Intronic
1072865914 10:99061375-99061397 TTATAAATTCAGATATTGAAAGG - Intronic
1072965741 10:99971176-99971198 GAATCAACACAGAGATGGAATGG + Intronic
1073485704 10:103817629-103817651 CTATGAACACAGGTAAGGCATGG - Intronic
1073724072 10:106209681-106209703 TTGAAAACACAGATATGGAAGGG - Intergenic
1075056329 10:119221385-119221407 CTATAAACACAGATATGGAAAGG - Intronic
1075830295 10:125404612-125404634 CTATAAAGACACACATGGACTGG - Intergenic
1077356181 11:2119748-2119770 CTATAAGCACAGACATACAATGG + Intergenic
1077640142 11:3873928-3873950 CTATAACCACAGAGATTAAAAGG - Intronic
1078749217 11:14143865-14143887 CTAAACACAAGGATATGGAAAGG + Intronic
1080316203 11:30952010-30952032 ATATAAACACAGAAAGGAAAGGG + Intronic
1080971129 11:37278755-37278777 AACTAAACTCAGATATGGAACGG - Intergenic
1081000362 11:37662435-37662457 CTATAAAGACATTTATGGCATGG + Intergenic
1081014417 11:37858035-37858057 CTACAAACATAGATAAGGAAGGG - Intergenic
1081463366 11:43292386-43292408 CTATAAAGACACATATAGACTGG + Intergenic
1081903648 11:46651906-46651928 CTTTAAACACTGGTATGAAAAGG - Intronic
1082165915 11:48950431-48950453 ATAGAAACACAGATATAAAAGGG - Intergenic
1082610680 11:55293508-55293530 ATAGAAACACAGATATAAAAGGG + Intergenic
1082659262 11:55890168-55890190 ATAGAAACACAGATATAAAAGGG - Intronic
1082802106 11:57422575-57422597 TTATAAAGACAGAAATTGAATGG - Intronic
1083850650 11:65364578-65364600 ATATATACCCAGAAATGGAATGG + Intergenic
1083866967 11:65460512-65460534 CTAAAAACACAGAAATGGTCTGG - Intergenic
1084234529 11:67778320-67778342 ATATAGATATAGATATGGAAAGG - Intergenic
1085754033 11:79189114-79189136 ATGTAAACACAGATATGGTATGG + Intronic
1086162433 11:83737571-83737593 TTATAAACACAGATTGGAAAAGG + Intronic
1086697054 11:89859706-89859728 ATAGAAACACAGATATAAAAGGG - Intergenic
1086709104 11:89984781-89984803 ATAGAAACACAGATATAAAAGGG + Intergenic
1088297622 11:108317866-108317888 CTAAAAACAGAAATATGAAAAGG + Intronic
1089016626 11:115170660-115170682 AGATAAACACAGATAAGGCAAGG + Exonic
1090068428 11:123523814-123523836 CTTTCAGCACAGATATTGAAGGG - Intergenic
1090961930 11:131564954-131564976 CTAGAAACACAGCAAGGGAAAGG - Intronic
1096438698 12:51619186-51619208 CTCTGGACACTGATATGGAAAGG - Intronic
1097490249 12:60259382-60259404 CTATAAATACACTAATGGAAGGG + Intergenic
1098035057 12:66293223-66293245 CTATAATCCCAGCTATGGAGAGG - Intergenic
1099348929 12:81540094-81540116 CTATAAACACAAATATCTATTGG - Intronic
1100140058 12:91606923-91606945 CCAGTAAAACAGATATGGAAAGG + Intergenic
1100198487 12:92273748-92273770 CTATTCACACAGATATGGGGAGG - Intergenic
1100549420 12:95633201-95633223 CGATGAACACAGATAAGGAAGGG - Intergenic
1100754860 12:97740027-97740049 CTATAAATAGATATCTGGAAGGG + Intergenic
1101688218 12:107047403-107047425 CAATAAACACTGATATGGTTTGG + Intronic
1101907855 12:108841002-108841024 ATATAAACACAGATCTAGATTGG + Intronic
1103239575 12:119401735-119401757 CTATAAACAGAGAAATGTGATGG - Intronic
1105323190 13:19346639-19346661 TTAGAAACTCAGAAATGGAAAGG + Intergenic
1105720993 13:23114262-23114284 CTAGGAGCACAGACATGGAAAGG + Intergenic
1105874198 13:24539225-24539247 TTAGAAACTCAGAAATGGAAAGG - Intergenic
1106223198 13:27764839-27764861 TTATATGCACAGATATAGAAAGG + Intergenic
1106999178 13:35523698-35523720 CTATAATAACTGATATAGAAGGG - Intronic
1109666086 13:65539939-65539961 ATAGAAACACAGATAGGTAAAGG - Intergenic
1111705259 13:91740561-91740583 CTATATAAACAGAAATGGATTGG - Intronic
1111926960 13:94473896-94473918 CTATAAACTTAGAAATGAAAGGG - Intronic
1112359903 13:98708068-98708090 ATATAAACAAAGATATTAAAAGG + Intronic
1112470183 13:99681434-99681456 GTATAAATACAGATATAGATAGG - Intronic
1112892206 13:104251605-104251627 CTCTAAACACAAATTAGGAAAGG + Intergenic
1114913962 14:27238439-27238461 GTTTAAAGACAGATAAGGAAAGG + Intergenic
1115697974 14:35921181-35921203 CTATAGTCATAGATATGGCAGGG + Intronic
1116610982 14:47071493-47071515 CTTTAAACACACCTAAGGAAAGG - Intronic
1116760005 14:49000282-49000304 CTAAAAACACAGAAATGTACAGG + Intergenic
1118073525 14:62272123-62272145 CTATAAACACTAATATTGCATGG - Intergenic
1119495154 14:75071516-75071538 CTATAATCAGAGAACTGGAATGG - Exonic
1120075929 14:80158337-80158359 ATATAAACACATATATATAATGG + Intergenic
1121977357 14:98417579-98417601 TTCTAAACACAGGTATGGGAGGG - Intergenic
1122955578 14:105069185-105069207 CTAAACACAGAGACATGGAAGGG - Intergenic
1124212969 15:27778527-27778549 CTTTAAAAACAGATATGCAAGGG - Intronic
1124347043 15:28930034-28930056 CTATAAAAACAGGTAGGAAAAGG + Intronic
1124824727 15:33082479-33082501 CTATAAACAAAGACATGGGTGGG - Intronic
1125063475 15:35453289-35453311 ATATATACACATATATGTAATGG + Intronic
1125811296 15:42543661-42543683 GTGTTAACACAGAGATGGAATGG + Exonic
1127201515 15:56658305-56658327 CTATAAACACATAAATTGTATGG + Intronic
1127227116 15:56942767-56942789 CTTTAAAGAAAGAAATGGAAAGG - Intronic
1128895341 15:71367789-71367811 CTATATACACAGTAATGGGATGG + Intronic
1129980231 15:79862716-79862738 CTATAAATATAAATTTGGAAGGG - Intronic
1131647309 15:94359442-94359464 ATTTAAACACAGATGTTGAAAGG + Intronic
1132059839 15:98683072-98683094 CTATAACCACAGAAAGAGAAAGG - Intronic
1136028789 16:27487851-27487873 GCATAAACACAGATATTAAAAGG + Intronic
1138159432 16:54739561-54739583 CTATAAACACTGTTATTAAATGG - Intergenic
1138857848 16:60716194-60716216 CTGTAAACACAGATTTTGAAAGG - Intergenic
1139482783 16:67239904-67239926 TAATAAACACAGATGAGGAAGGG + Intronic
1141288044 16:82690985-82691007 CTATAAAGACACATAGGAAATGG + Intronic
1141898186 16:86971984-86972006 ATAGAAACACAGAGAGGGAATGG - Intergenic
1142543391 17:679550-679572 ATATAAACAGAGAATTGGAAAGG + Intronic
1143239088 17:5428746-5428768 ATACATACACATATATGGAAAGG - Intronic
1143641475 17:8200706-8200728 CTCTAAACAAAGAAAAGGAAGGG + Intergenic
1143991442 17:10966742-10966764 CTATGAAGTCAGATAGGGAATGG + Intergenic
1148523386 17:48304248-48304270 TTTTAAATACAGATAAGGAAAGG + Intronic
1148587727 17:48792710-48792732 ATATAAAGACAGATAAGCAAAGG + Intronic
1148898631 17:50857360-50857382 CAATAAGCACAGACAAGGAATGG + Intergenic
1150043862 17:61891966-61891988 CTCTAAATACAGATATGGTAGGG - Intronic
1152976181 18:221553-221575 TTAAAAATAAAGATATGGAAAGG - Intronic
1153633784 18:7096680-7096702 ATATATATACACATATGGAATGG - Intronic
1153831216 18:8924562-8924584 GTATAAACACACATATTTAAAGG + Intergenic
1154261924 18:12842524-12842546 ATGTAAGCACAGATGTGGAAGGG + Intronic
1154357249 18:13631192-13631214 CAATAAATACAGAAATGAAAAGG + Intronic
1156956895 18:42977685-42977707 ATATAAACACATATATACAATGG + Intronic
1157871809 18:51236426-51236448 CTATACAAATAGATAAGGAAAGG - Intergenic
1158762050 18:60401571-60401593 CTTTACACAGAGATAAGGAATGG + Intergenic
1160278912 18:77468388-77468410 ATATAAGCACAGATTTGGAAGGG + Intergenic
1162617072 19:11810566-11810588 CTATAAAAACTGATAGGCAATGG - Intergenic
1162865665 19:13544743-13544765 CTACACACACTGTTATGGAAAGG - Intronic
1164780642 19:30888988-30889010 GGATAAACACAGATATAGATAGG + Intergenic
1165987068 19:39778737-39778759 CTAAATAAACAGATATTGAATGG + Intronic
1167164805 19:47791198-47791220 CTAAAAACACAAAAATGGCATGG + Intergenic
925285226 2:2711414-2711436 CTGAAAACAGAGACATGGAATGG - Intergenic
925577387 2:5374505-5374527 CTACAAAGACAGAGATGAAATGG + Intergenic
926554123 2:14336670-14336692 ATATATACACATATATGTAAAGG - Intergenic
926577611 2:14599609-14599631 TTAAAAACACAGATATGCAAAGG - Intergenic
928216277 2:29364050-29364072 CTATAAACACAGATTCAAAATGG + Intronic
929036687 2:37699867-37699889 ATAGAAACACAGAGAAGGAATGG + Intronic
929442432 2:41974653-41974675 CTATACATACACATACGGAATGG - Intergenic
930215383 2:48691107-48691129 TTATAAATACATATATGTAATGG - Intronic
930661334 2:54057077-54057099 CTATCAACCCAAATATTGAAAGG - Intronic
931292232 2:60882942-60882964 CTATATACACAGATGTGGTTGGG + Intronic
931983578 2:67720362-67720384 ATATACATACATATATGGAAGGG - Intergenic
932624763 2:73288647-73288669 CTATTACCAGAAATATGGAAGGG + Intergenic
932826322 2:74944282-74944304 CTGTAAACACATGTATGGCATGG + Intergenic
932843882 2:75114918-75114940 TTGTAAACACAGACAGGGAATGG + Intronic
932947417 2:76252275-76252297 ATATAAACACATGAATGGAAAGG - Intergenic
934593366 2:95579340-95579362 ATAGAAACACAGATATAAAAGGG - Intergenic
935662423 2:105478634-105478656 CTATAAAGACAGAAATGTTAGGG + Intergenic
937114285 2:119393167-119393189 CAATAAACACACTTATTGAATGG + Intergenic
938310996 2:130288006-130288028 CTTTAAGGACAGAGATGGAATGG - Intergenic
938889186 2:135685327-135685349 ATACTAACACAGATATGGTACGG + Intronic
939114769 2:138048109-138048131 CTATATACACAGATAAGGTCTGG - Intergenic
939750482 2:146039054-146039076 CTATATAAACAGATATTGACTGG - Intergenic
940698752 2:157014940-157014962 CTATGAACACACATATTGAAGGG - Intergenic
940704999 2:157093574-157093596 CAATAAACACATCTAGGGAAAGG + Intergenic
941949069 2:171134248-171134270 CTTTAAAAACAATTATGGAATGG + Intronic
944745876 2:202655593-202655615 TTCTAAAAACAGATAAGGAAGGG - Intronic
946135149 2:217639913-217639935 GTATATACCCAGAAATGGAATGG - Intronic
946179004 2:217938792-217938814 CTGTAAACACAGATCTGCATGGG + Intronic
1169608853 20:7355741-7355763 CTATAAAGGCATATATGAAATGG - Intergenic
1171933935 20:31255976-31255998 CTATAAAGAAAAATAGGGAAAGG - Intergenic
1172765533 20:37348767-37348789 ATATAATCACAGATATGATAAGG + Intronic
1173755621 20:45513197-45513219 CTATAAAAGTAGATCTGGAAGGG - Intronic
1174737469 20:52978403-52978425 GTATAAATACAGTGATGGAAGGG - Intronic
1175065411 20:56282220-56282242 CTATATACTCAGAAGTGGAAGGG - Intergenic
1175083729 20:56442135-56442157 CTGTCAACACAGATATAGAAAGG - Intronic
1175637027 20:60593282-60593304 ATATAGACATAGATATAGAAGGG - Intergenic
1175681847 20:60994926-60994948 CTACAAGGACAGATATGAAAGGG - Intergenic
1178307952 21:31506305-31506327 CCTTAAAAAAAGATATGGAAGGG - Intronic
1178419842 21:32434644-32434666 ATATAGATATAGATATGGAAAGG + Intronic
1179173195 21:38989002-38989024 CTATAGTCACAGCTGTGGAACGG + Intergenic
1179487587 21:41720604-41720626 GTATAAACCCAGGAATGGAATGG + Intergenic
1180156274 21:45978740-45978762 CTATAAACACACTTATAGCACGG + Intergenic
1181955245 22:26583518-26583540 CTAGAAACACAGAGCTGGAAGGG + Intronic
1183878319 22:40803600-40803622 CAATTAACACAGATATGCAGAGG + Intronic
949236110 3:1810620-1810642 CTATAAACACTAATATGGAAAGG + Intergenic
950565533 3:13767664-13767686 CTAGAAAAACAGGTATGGAGTGG - Intergenic
951608155 3:24460171-24460193 CTTTAAACACCAAAATGGAAAGG + Intronic
952199938 3:31115802-31115824 GTATAAACACAGTAATGGGATGG - Intergenic
954475365 3:50739302-50739324 AAATAAACACAGTTAAGGAAGGG - Intronic
956253612 3:67260929-67260951 CTATGAACAGAGATAAGAAATGG - Intergenic
958159661 3:89801495-89801517 ATATAGATACAGAGATGGAAAGG + Intergenic
958989444 3:100825394-100825416 CTAGAAACTCAGATGTGCAAAGG + Intronic
959029772 3:101285149-101285171 CTATAAATGCAGATGTGTAAGGG + Intronic
959775566 3:110157568-110157590 CTAAAAATACACATATCGAAAGG - Intergenic
959859360 3:111199349-111199371 CTGTAAACACAGCTACAGAATGG - Intronic
960304906 3:116049489-116049511 CTACAAACACAGAGTTTGAAAGG - Intronic
960344637 3:116517739-116517761 CTGTTAACATAGGTATGGAATGG + Intronic
960813196 3:121644980-121645002 AAATAAATACAGATATGGAGTGG + Intronic
960824784 3:121771265-121771287 CTTTAAACACAGAAATGGCCGGG - Intronic
961772041 3:129257197-129257219 GCATAAATACAGATATGGAAAGG - Intronic
961989891 3:131177464-131177486 CTACCAAAACAGATATAGAATGG + Intronic
962068074 3:132004202-132004224 ATATAGACATAGATATAGAATGG - Intronic
963148343 3:142017902-142017924 CTACATCTACAGATATGGAAAGG - Intronic
964179186 3:153863954-153863976 TTAAAAACACAGATATTCAAAGG - Intergenic
964618869 3:158700522-158700544 CTATAAAAACAAAAATGTAAGGG - Intronic
964629134 3:158790545-158790567 CTAAATACACAAATATAGAAGGG + Intronic
965005000 3:163009797-163009819 GTATAAAAATAGATAAGGAATGG - Intergenic
965526827 3:169729301-169729323 CTATAAAGACAGACATAGACTGG - Intergenic
965633139 3:170753966-170753988 ATATACACATAGATATGCAAAGG - Intronic
966331192 3:178816318-178816340 CTATAACTACAGATAAGGTATGG - Intronic
967290156 3:187911741-187911763 CTCTTGACAGAGATATGGAAAGG + Intergenic
969820620 4:9717423-9717445 ATATAGATATAGATATGGAAAGG + Intergenic
969943185 4:10755597-10755619 CTAGAAAAGCAAATATGGAAAGG - Intergenic
970210722 4:13707329-13707351 CTTGAAACACAAATAAGGAATGG - Intergenic
970798376 4:19942790-19942812 TTTAAAAGACAGATATGGAATGG - Intergenic
971190071 4:24419499-24419521 CGAAAAACACAGAGATGAAAAGG + Intergenic
971334273 4:25708125-25708147 CCATACACACAGACATGGATTGG - Intergenic
972011488 4:34189039-34189061 CTACAAACACTGATATGGTTTGG + Intergenic
973277673 4:48327086-48327108 CTATCACCACTGATATGGACAGG + Intergenic
973333411 4:48932340-48932362 GTATAAACACAGATTGGGCATGG + Intergenic
974711284 4:65599171-65599193 CTATAAACACTGTGATGGATTGG + Intronic
977439703 4:97048437-97048459 TTATAAAAAGAGATATGAAATGG + Intergenic
978184320 4:105839123-105839145 AAATATGCACAGATATGGAAAGG + Intronic
978714170 4:111822107-111822129 CTATAAACAAATATATAAAAGGG - Intergenic
979752126 4:124291693-124291715 CTATAAACAAATATATTGGAAGG - Intergenic
980103229 4:128562706-128562728 TTCTAAACACAGATATCTAAGGG + Intergenic
980666438 4:135943289-135943311 CTATAACCACAGATCTGGTAGGG - Intergenic
982529931 4:156527230-156527252 GTAGAAACACATATATTGAATGG + Intergenic
982889993 4:160835304-160835326 CCATGAACCCAGATATGCAATGG + Intergenic
983263574 4:165484018-165484040 ATATAAAACCAGATATTGAATGG + Intronic
984339387 4:178435866-178435888 CTGTAAGTACAGATATGGGAAGG + Intergenic
984672198 4:182503414-182503436 CTATACACACAAATAAGCAAGGG - Intronic
986046926 5:4047511-4047533 CTATAAAGACACACATAGAAAGG + Intergenic
986989926 5:13539789-13539811 CTTTAATCACAGAGATGTAAGGG - Intergenic
987333668 5:16879348-16879370 CTTTAAACACAGAGTTGGCAGGG + Intronic
988327496 5:29788618-29788640 GTTTAACCACAGATATGTAATGG - Intergenic
988426210 5:31068040-31068062 CTATAAACACATAAATGCAATGG - Intergenic
988950476 5:36253510-36253532 CTATAAACAGACATAATGAATGG + Intronic
989114431 5:37938735-37938757 TTATAAACTCAGACATGGAGGGG - Intergenic
989250432 5:39308065-39308087 CTATAAACACCGATAGCGCATGG - Intronic
991438202 5:66617776-66617798 ATAGAAGCACAGATTTGGAAAGG + Intronic
991564378 5:67989640-67989662 GCATAAACACAGACAGGGAAAGG + Intergenic
992725705 5:79605047-79605069 CTATAAACATTGATATGGTTAGG - Intergenic
993342041 5:86736701-86736723 CTATAAACACACATATAGGATGG - Intergenic
993405018 5:87500283-87500305 CTAGAAACACATGGATGGAATGG + Intergenic
993711763 5:91231899-91231921 CTATATACACTGATATGGAATGG - Intergenic
993738841 5:91511140-91511162 CTATAAACAAACAAATGAAATGG - Intergenic
994262792 5:97679771-97679793 GTATATACCCAGATATGGGATGG + Intergenic
995044425 5:107629327-107629349 CCATTAACATATATATGGAAAGG - Intronic
995349952 5:111163731-111163753 GTATTAACACAGAGAGGGAAGGG + Intergenic
995385783 5:111587017-111587039 ATATAAATACAGATATGATATGG - Intergenic
996106330 5:119508415-119508437 TTATAAACAAAAATAAGGAAAGG - Intronic
996294542 5:121896105-121896127 CTCAAAACACAGATAAGGGAAGG + Intergenic
997039786 5:130238649-130238671 TTATAAACACAGAATTTGAAAGG - Intergenic
997147962 5:131458134-131458156 CTATAAAAACTGATATGGTTTGG + Intronic
999928065 5:156401199-156401221 CTATTAAAGCAGCTATGGAAAGG + Intronic
1001595810 5:172898067-172898089 CTGTAAACACAGAAATGAAGAGG - Intronic
1003183307 6:3810203-3810225 CTATAAACACAGAGCTTGCAAGG - Intergenic
1003584290 6:7372645-7372667 AAAGAAAAACAGATATGGAAAGG - Intronic
1005118159 6:22361451-22361473 CTAAAAAAAGAGAGATGGAATGG + Intergenic
1005394817 6:25370411-25370433 AAATAAACACAGTGATGGAAAGG - Intronic
1008603502 6:53118045-53118067 TTATAATCACAGAAATGCAAGGG - Intergenic
1009825409 6:68859790-68859812 CAATAAACACTGATATGGTTTGG - Intronic
1009918459 6:70025821-70025843 CTAGAATAACAGATGTGGAAGGG + Intronic
1010299272 6:74241101-74241123 CTATAAAGACAAATATAGACTGG - Intergenic
1010588442 6:77683585-77683607 CTATAGAGACAGAGATAGAATGG - Intergenic
1011406217 6:87018076-87018098 CTAAAAACACGGAGGTGGAAAGG - Intergenic
1011736047 6:90311562-90311584 CTAAAAGGACAGATATAGAATGG - Intergenic
1011868325 6:91860463-91860485 CTATAAATACAGTTAATGAATGG - Intergenic
1012541284 6:100365041-100365063 ATATAAACACTGGTATGAAAAGG - Intergenic
1013351396 6:109309205-109309227 ATATAAACACACATATGCAGAGG - Intergenic
1014571071 6:123008743-123008765 CTATAAACACAGGCATTGGAAGG - Intronic
1014935275 6:127378879-127378901 CTAAAAAAAAAGATTTGGAAAGG + Intergenic
1015018281 6:128440722-128440744 CTTTATATACTGATATGGAAAGG - Intronic
1016630822 6:146228916-146228938 CTATAAACAAAGATATTTATTGG - Intronic
1017595010 6:156018891-156018913 CTATATACCCAGAAATGGGATGG + Intergenic
1017846966 6:158266995-158267017 TTATAGACACAGAAATAGAATGG - Intronic
1018526225 6:164712853-164712875 ATATATACACATATATGTAATGG - Intergenic
1020134593 7:5579932-5579954 CTAAAAACACAAATATGGCCGGG + Intergenic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1024062605 7:45710148-45710170 CTGTAATCACAGATATTGAAAGG + Intronic
1024341159 7:48262049-48262071 CTAACAACACACAGATGGAAAGG + Intronic
1024819289 7:53308233-53308255 CTATAAGCACATTTAAGGAAAGG + Intergenic
1024928391 7:54642425-54642447 CTATAGATACGGATATGGATAGG + Intergenic
1025480651 7:60978690-60978712 GTATATACACAGTAATGGAACGG + Intergenic
1026412882 7:70143773-70143795 ATATAATCACAGATTTGGAATGG + Intronic
1026634581 7:72070174-72070196 CTATAACAACACATATGAAAAGG + Intronic
1028280749 7:88925043-88925065 CTACAAACAAAGATTTGGAAAGG - Intronic
1030636223 7:111952169-111952191 CCATAAACACAGATATGTTGTGG - Intronic
1030879763 7:114863306-114863328 CTATAAACTCAGATAAGTAATGG - Intergenic
1031420358 7:121544264-121544286 CCATAAACACATCTATTGAAAGG - Intergenic
1032232427 7:130086827-130086849 TTAAAAACACAGATATTAAAAGG - Intronic
1033706061 7:143885782-143885804 ATATAAACACAGAAATTGTATGG + Intronic
1035975628 8:4307559-4307581 CTGTAAACACAGATAAGCAGAGG - Intronic
1036413327 8:8523028-8523050 CTATAAATACACATATAGGAGGG - Intergenic
1036424742 8:8634161-8634183 CTATACACATATATATGAAATGG + Intergenic
1036595050 8:10204451-10204473 CTATAAGCACAGAAAAGGTACGG - Intronic
1037040754 8:14229194-14229216 CTACAAACAGAAATATGGACTGG - Intronic
1037044611 8:14282794-14282816 CTAGAAAAACAAATATTGAAAGG - Intronic
1037247657 8:16855025-16855047 GTATAAACACACATATTTAAAGG - Intergenic
1037406690 8:18549880-18549902 CTAAAAATACAGAGTTGGAAGGG + Intronic
1037409746 8:18583723-18583745 CTATGGAAACACATATGGAAGGG - Intronic
1037565534 8:20115130-20115152 CTAATAGCACAGATAAGGAAAGG + Intergenic
1037575074 8:20194810-20194832 CTGTAACCTCAGATATGGAATGG - Intergenic
1037589303 8:20300019-20300041 CCACAAGCACAGTTATGGAAGGG - Intronic
1038232358 8:25713999-25714021 GTATAACCACGGATATGGTAAGG - Intergenic
1040503287 8:48024229-48024251 GTAGAAATACAGATATGAAATGG + Intronic
1041745017 8:61199019-61199041 CAATAAACACTCATATGCAAGGG + Intronic
1042968732 8:74385043-74385065 CTAGAATCACAGAACTGGAAAGG + Intronic
1044200912 8:89435006-89435028 CTGTAAACAAAGATGTCGAAAGG + Intergenic
1044569999 8:93706634-93706656 CTGTAAACACTGCTGTGGAAGGG + Intronic
1047670417 8:127140303-127140325 CTAATTACACAGATATGGGAAGG + Intergenic
1047894014 8:129344995-129345017 ATATAAACACATGTAGGGAAAGG + Intergenic
1050244174 9:3670447-3670469 CTCTAAATACAAATATGAAAAGG + Intergenic
1051244926 9:15100447-15100469 CCACAGACACAGCTATGGAATGG + Intergenic
1051779900 9:20678851-20678873 CTATAAACAGAGGTATGGGCAGG - Intronic
1051942179 9:22521066-22521088 CTATAATCCCAGATATTGGAAGG - Intergenic
1052149452 9:25096212-25096234 TCATAACCACAAATATGGAAAGG - Intergenic
1052158045 9:25219395-25219417 CTAGAAACACATTTATAGAAAGG + Intergenic
1052217608 9:25985923-25985945 CTATAAACACGTCTATGCAAAGG + Intergenic
1052772500 9:32702748-32702770 CTCAAAACTCAGATTTGGAAAGG + Intergenic
1054921477 9:70547268-70547290 GTATATACACACATTTGGAAAGG - Intronic
1056656344 9:88512617-88512639 CTATAAACAAAGATGTTCAAAGG - Intergenic
1057488001 9:95501013-95501035 CTATAAATACAGGAATGGGATGG + Intronic
1058458857 9:105164010-105164032 CTATACATACTGAAATGGAAAGG - Intergenic
1059418813 9:114178513-114178535 CTATATGGACAGATATGGCATGG + Intronic
1059686313 9:116640242-116640264 AGATAAACTCAGAAATGGAAGGG - Intronic
1062154820 9:135041286-135041308 GGAGAAACACTGATATGGAAGGG + Intergenic
1186275452 X:7933454-7933476 ATCTCAGCACAGATATGGAAAGG - Intergenic
1188671205 X:32883974-32883996 TAATAAAGACAGAAATGGAAAGG + Intronic
1189753003 X:44241856-44241878 ATATATAGATAGATATGGAAAGG + Intronic
1190018359 X:46849103-46849125 CTAGAATCACAAACATGGAAAGG - Intronic
1191049090 X:56171878-56171900 GTATATACACAGTAATGGAATGG + Intergenic
1193761939 X:85477612-85477634 CTACAAACACAAATAAGGTATGG + Intergenic
1194338222 X:92676382-92676404 CTATAAGCACAGATAGCCAAAGG - Intergenic
1194889376 X:99358464-99358486 ATATCAAAACATATATGGAATGG - Intergenic
1195811422 X:108835738-108835760 CTATATACACACATATGGGTAGG + Intergenic
1196006242 X:110840341-110840363 CTACAACCACAGAAATGTAAGGG + Intergenic
1196328087 X:114432889-114432911 CTATGAACTCAGAGAAGGAAAGG - Intergenic
1197341475 X:125272021-125272043 TCATAAACACAGATACAGAAAGG - Intergenic
1198556720 X:137801550-137801572 CTATATGCACTGACATGGAAAGG - Intergenic
1200646624 Y:5793163-5793185 CTATAAGCACAGATAGCCAAAGG - Intergenic
1201385338 Y:13434563-13434585 ATATAAACATAGGTATGGCATGG + Intronic
1201963873 Y:19710205-19710227 CTGTACACACAGAGATGGTATGG + Intronic