ID: 1075058141

View in Genome Browser
Species Human (GRCh38)
Location 10:119235354-119235376
Sequence CTCACTAGCATGTAAGTAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075058139_1075058141 -10 Left 1075058139 10:119235341-119235363 CCATATCCTGGAACTCACTAGCA 0: 1
1: 0
2: 1
3: 9
4: 117
Right 1075058141 10:119235354-119235376 CTCACTAGCATGTAAGTAATTGG No data
1075058137_1075058141 0 Left 1075058137 10:119235331-119235353 CCCTGGAAAACCATATCCTGGAA 0: 1
1: 0
2: 1
3: 13
4: 174
Right 1075058141 10:119235354-119235376 CTCACTAGCATGTAAGTAATTGG No data
1075058138_1075058141 -1 Left 1075058138 10:119235332-119235354 CCTGGAAAACCATATCCTGGAAC 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1075058141 10:119235354-119235376 CTCACTAGCATGTAAGTAATTGG No data
1075058135_1075058141 8 Left 1075058135 10:119235323-119235345 CCTATTATCCCTGGAAAACCATA 0: 1
1: 0
2: 1
3: 14
4: 176
Right 1075058141 10:119235354-119235376 CTCACTAGCATGTAAGTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075058141 Original CRISPR CTCACTAGCATGTAAGTAAT TGG Intronic
No off target data available for this crispr