ID: 1075060931

View in Genome Browser
Species Human (GRCh38)
Location 10:119256281-119256303
Sequence CTGGTGCTGTGAGGTGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 519
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 473}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075060931_1075060939 -6 Left 1075060931 10:119256281-119256303 CCCCACACACCTCACAGCACCAG 0: 1
1: 0
2: 4
3: 41
4: 473
Right 1075060939 10:119256298-119256320 CACCAGCCTGGGAGCTTGGGAGG No data
1075060931_1075060948 23 Left 1075060931 10:119256281-119256303 CCCCACACACCTCACAGCACCAG 0: 1
1: 0
2: 4
3: 41
4: 473
Right 1075060948 10:119256327-119256349 GAAACCAGCAGGTGGGAGTCTGG No data
1075060931_1075060947 16 Left 1075060931 10:119256281-119256303 CCCCACACACCTCACAGCACCAG 0: 1
1: 0
2: 4
3: 41
4: 473
Right 1075060947 10:119256320-119256342 GGGGCGTGAAACCAGCAGGTGGG No data
1075060931_1075060946 15 Left 1075060931 10:119256281-119256303 CCCCACACACCTCACAGCACCAG 0: 1
1: 0
2: 4
3: 41
4: 473
Right 1075060946 10:119256319-119256341 GGGGGCGTGAAACCAGCAGGTGG No data
1075060931_1075060937 -10 Left 1075060931 10:119256281-119256303 CCCCACACACCTCACAGCACCAG 0: 1
1: 0
2: 4
3: 41
4: 473
Right 1075060937 10:119256294-119256316 ACAGCACCAGCCTGGGAGCTTGG No data
1075060931_1075060942 -4 Left 1075060931 10:119256281-119256303 CCCCACACACCTCACAGCACCAG 0: 1
1: 0
2: 4
3: 41
4: 473
Right 1075060942 10:119256300-119256322 CCAGCCTGGGAGCTTGGGAGGGG No data
1075060931_1075060940 -5 Left 1075060931 10:119256281-119256303 CCCCACACACCTCACAGCACCAG 0: 1
1: 0
2: 4
3: 41
4: 473
Right 1075060940 10:119256299-119256321 ACCAGCCTGGGAGCTTGGGAGGG No data
1075060931_1075060945 12 Left 1075060931 10:119256281-119256303 CCCCACACACCTCACAGCACCAG 0: 1
1: 0
2: 4
3: 41
4: 473
Right 1075060945 10:119256316-119256338 GGAGGGGGCGTGAAACCAGCAGG No data
1075060931_1075060943 -3 Left 1075060931 10:119256281-119256303 CCCCACACACCTCACAGCACCAG 0: 1
1: 0
2: 4
3: 41
4: 473
Right 1075060943 10:119256301-119256323 CAGCCTGGGAGCTTGGGAGGGGG No data
1075060931_1075060938 -9 Left 1075060931 10:119256281-119256303 CCCCACACACCTCACAGCACCAG 0: 1
1: 0
2: 4
3: 41
4: 473
Right 1075060938 10:119256295-119256317 CAGCACCAGCCTGGGAGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075060931 Original CRISPR CTGGTGCTGTGAGGTGTGTG GGG (reversed) Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
900270568 1:1785196-1785218 CTGTTGCTGTGAGGTCTGACGGG - Intergenic
900984797 1:6066930-6066952 CCGGTGCTGTGACTTGTATGTGG + Intronic
900995542 1:6121452-6121474 CTGGGCCTGTGGTGTGTGTGGGG - Intronic
902391571 1:16110056-16110078 CTGGTGCTGTGTGGTGGTTAGGG + Intergenic
902881931 1:19377520-19377542 CTTGAGCTTTGAGGTGGGTGGGG - Intronic
902955471 1:19922038-19922060 CTGGAGCTGGGAGGTGTCTGTGG + Intronic
903053667 1:20620155-20620177 CTGCTGCTGTCTGGAGTGTGAGG + Intergenic
903191984 1:21662065-21662087 CTGGTCCTGAGAGGTCTGTATGG - Intronic
903213514 1:21831188-21831210 CAGGTGGTGTGTGGGGTGTGGGG + Intronic
903500215 1:23796450-23796472 CTGTTGCTGAGAGCTGGGTGGGG + Intronic
903661008 1:24978676-24978698 CTGGGGCTGGGAGGGGTGGGTGG - Intergenic
903773860 1:25780822-25780844 AGGGTGATGTCAGGTGTGTGTGG - Intronic
903811395 1:26036776-26036798 GTGGTGCTGTGAGATGCTTGAGG + Intergenic
903969107 1:27107596-27107618 GTTGTGGTGTGGGGTGTGTGTGG - Intronic
904402545 1:30266258-30266280 CTGATGCTGTGTGCTCTGTGTGG - Intergenic
904888977 1:33763786-33763808 CTGTTGGGGTGAGATGTGTGTGG + Intronic
905338331 1:37260575-37260597 CTGTTTCTCTGAGGTGGGTGGGG - Intergenic
907490998 1:54808705-54808727 ATGGTGCTGAGAGGTGGGGGTGG + Intronic
907985460 1:59525238-59525260 GTGGAGCAGTGAGGGGTGTGTGG - Intronic
909676812 1:78247783-78247805 GTGTTGATGTGAGGTATGTGTGG + Intergenic
910802790 1:91162383-91162405 GGGCTGCTGTGCGGTGTGTGGGG + Intergenic
913240595 1:116826298-116826320 CTGGGTGTGTGGGGTGTGTGAGG - Intergenic
915523625 1:156463205-156463227 GTGGTCCTGTGGGGTGTGTCAGG + Intergenic
917220202 1:172720572-172720594 GTGTTGCTCTGAGGAGTGTGAGG + Intergenic
917855409 1:179095292-179095314 TTGGGACTGTGAGGTGTTTGAGG + Exonic
919652210 1:200161521-200161543 TTGGGGCTGTGAGCTGTGTTAGG - Intronic
920160840 1:203996684-203996706 ATGGAACTATGAGGTGTGTGTGG + Intergenic
920172789 1:204082061-204082083 CTGGTGGTGGGGTGTGTGTGGGG + Intronic
920546484 1:206822718-206822740 CTACTACTGTGAGGTCTGTGGGG + Intronic
922342159 1:224666260-224666282 CTGGTACTGTGAGGTGTTAATGG + Intronic
922374676 1:224950462-224950484 ATGTTGCTGTGAGAAGTGTGAGG + Intronic
922701753 1:227765334-227765356 CTGGTGCTGCGAGGTGGACGGGG + Intronic
922852517 1:228745765-228745787 CTGGTGCCTGGAGGTGTGGGAGG + Exonic
923637355 1:235713043-235713065 CTGATGCTGCGATGTGTTTGTGG - Intronic
923921077 1:238565201-238565223 CTGGTGCAGTGAGAGGGGTGGGG + Intergenic
924878050 1:248127681-248127703 CTGCTGCTGTGAGGTCAATGGGG + Intergenic
1063117410 10:3081462-3081484 TTGGTGCTCTCAGGTGTGTTTGG + Intronic
1063367136 10:5498499-5498521 ATGGTGCTGGGCGGTGTCTGTGG - Intergenic
1063953165 10:11242863-11242885 CTGATGCTGGGAGGCTTGTGTGG + Intronic
1064710708 10:18121457-18121479 CTGTGAATGTGAGGTGTGTGAGG + Intergenic
1065020968 10:21501209-21501231 CTGTTGCTGGAAGCTGTGTGGGG - Intergenic
1067031687 10:42882368-42882390 CTGCTGATGTTAAGTGTGTGAGG + Intergenic
1067233185 10:44426089-44426111 CTGGTGGTGTGGTGTTTGTGGGG + Intergenic
1067469500 10:46526041-46526063 ATGGTTCTGTGTGGTTTGTGTGG - Intergenic
1067758507 10:49025491-49025513 CTGGGGATGGGAGGTGTGTGTGG - Intronic
1067839643 10:49665604-49665626 CTTGGGCTCTGTGGTGTGTGTGG - Intergenic
1068961795 10:62874050-62874072 CAGAGGCTGTGAGGGGTGTGTGG - Intronic
1069714981 10:70514818-70514840 GGGGTGCTTTGAGGTGGGTGGGG + Intronic
1069807304 10:71133990-71134012 CTGGTACTGTGGGGTGCCTGGGG - Intergenic
1073037024 10:100571128-100571150 CTGGCTCTGTGGGGGGTGTGTGG + Intergenic
1073116919 10:101096485-101096507 TAGGTGATGTAAGGTGTGTGGGG - Intronic
1073327634 10:102651600-102651622 CCTGTGGTGTGAGATGTGTGGGG + Intronic
1073372098 10:102999650-102999672 CTGGTGCGGAGAGGTGGGGGGGG - Intronic
1075060931 10:119256281-119256303 CTGGTGCTGTGAGGTGTGTGGGG - Intronic
1076059254 10:127400772-127400794 CTGGGGGTGGGAGGTGGGTGAGG - Intronic
1076104650 10:127811690-127811712 AAGGTGGTGTGAAGTGTGTGTGG + Intergenic
1076546195 10:131246951-131246973 CTGGTGGGGTGAGATGTGTAGGG + Intronic
1076546216 10:131247039-131247061 CTGGTGGGGTGAGATGTGTAGGG + Intronic
1076687515 10:132204704-132204726 CTGGTGGTGGCAGGTGTGCGGGG + Intronic
1076802852 10:132839457-132839479 CGGGTGCTGTTCCGTGTGTGTGG - Intronic
1076901229 10:133339033-133339055 TGTGTGGTGTGAGGTGTGTGTGG - Intronic
1077020373 11:414522-414544 GTGGTAATGGGAGGTGTGTGTGG - Intronic
1077200113 11:1302539-1302561 CTGGTGCTGTGAAGGGTGGTGGG - Intronic
1077309284 11:1881351-1881373 CGGGCGCCGTGAGGTGAGTGTGG + Intronic
1077356552 11:2121515-2121537 CTGGTGGTGTGAGCGGGGTGAGG - Intergenic
1077467175 11:2738892-2738914 CGGGTGCAGTGAGGTGCCTGCGG + Intronic
1078867045 11:15307643-15307665 CTGCTGCAGTGAGGGGTGTCAGG - Intergenic
1079142262 11:17819766-17819788 CTGGTTCTTTGATGTGTGAGGGG - Intronic
1079204252 11:18400217-18400239 CTGGTGCTGTTAAGTGTGAAAGG - Intronic
1079422396 11:20305858-20305880 GTGGGGCTGTGGGGTGTGGGTGG + Intergenic
1081402990 11:42664278-42664300 CTTGTTCTGTGAGATGTTTGGGG - Intergenic
1082044743 11:47715501-47715523 CTGGGGCTGTGATGTATGAGGGG - Intergenic
1083161599 11:60857792-60857814 CTGGTGCTGAGATGTGTCTGTGG - Intergenic
1083200228 11:61116759-61116781 GTGGTGGTGCGTGGTGTGTGTGG - Intronic
1084575258 11:69984950-69984972 CTGGAGATGTCAGGGGTGTGAGG + Intergenic
1084600314 11:70141629-70141651 CTGCGGCTGAGAGGTGTGAGCGG + Intronic
1086297583 11:85388087-85388109 TTGGTGCTGTTGGGGGTGTGGGG + Intronic
1087701750 11:101443086-101443108 CTGGTGCTGTGCATTGGGTGTGG + Intergenic
1088850028 11:113696826-113696848 CTGAGGCTGTTAGGTGAGTGGGG - Intronic
1089013464 11:115148329-115148351 GTGGTGCTGTGGAGTGTGTGGGG + Intergenic
1089533585 11:119147976-119147998 CTGTTACTCTGAGGTTTGTGTGG - Intergenic
1090253596 11:125267613-125267635 CTGGCGCTGGGAGATGTTTGGGG - Intronic
1091108658 11:132944670-132944692 GTGGTGCTGGGAGGTGACTGGGG + Intronic
1091755599 12:3049435-3049457 CAGGTGCTGTGAGCTGTATATGG - Intergenic
1092039015 12:5367085-5367107 CTGATGCTGGGAGGTTTGTTGGG + Intergenic
1092966310 12:13646928-13646950 CAGGAGCTGTGAGCTGTGAGTGG + Intronic
1093081894 12:14821983-14822005 CTGTACTTGTGAGGTGTGTGTGG + Intronic
1093258775 12:16906704-16906726 CTGGTGCTGCCATGTGTGTATGG - Intergenic
1094224813 12:28033187-28033209 CAGCTGGTGTGGGGTGTGTGGGG - Intergenic
1096802809 12:54122651-54122673 CTGGTGAGGTCAAGTGTGTGTGG + Intergenic
1097488981 12:60240591-60240613 CTGGGCCTGTGAGGGGTGGGAGG + Intergenic
1097573124 12:61357010-61357032 CTGCTGCTGCGAGGAGGGTGTGG - Intergenic
1098765792 12:74487095-74487117 TTGGCGATGTGAGGTTTGTGAGG + Intergenic
1102497746 12:113331070-113331092 CTGGTGCTGTGATTTGAATGGGG - Intronic
1103606999 12:122094389-122094411 GTGTTGGTGTGTGGTGTGTGTGG + Intronic
1103866080 12:124053086-124053108 CCGGAGCAGTGAGGTGTCTGGGG - Intronic
1104106508 12:125664987-125665009 CTGGTGATGAGAAGTGTGTTTGG + Intergenic
1104687477 12:130797124-130797146 CTGGCTCTGTGAGGTGCTTGGGG - Intronic
1104884837 12:132100655-132100677 TTGTGGCTGTGAGGTGTGTTTGG + Intronic
1106072338 13:26424623-26424645 CTGGTGCTGTTGGGGGTGGGGGG - Intergenic
1107324858 13:39230700-39230722 TTGGTGCTGTGAAATGTGTATGG - Intergenic
1107708597 13:43131258-43131280 TTGGTGGGGTGAGGGGTGTGAGG - Intergenic
1109254411 13:60061610-60061632 GTGGGGGTGGGAGGTGTGTGTGG - Intronic
1109988227 13:70017529-70017551 GTGGAGCAGTGAGGGGTGTGTGG - Intronic
1110116156 13:71819066-71819088 CTGGGGCTGCCAGGTGTGGGAGG + Intronic
1111655396 13:91145634-91145656 TTGGTGAGGGGAGGTGTGTGTGG + Intergenic
1112483571 13:99799909-99799931 CTGCAGCGGTGTGGTGTGTGAGG + Intronic
1112659119 13:101487249-101487271 CTGTTGCTGGGAGATGTTTGAGG + Intronic
1113518587 13:110921785-110921807 CTTGTGCTGTGAGGTATGAGCGG - Intergenic
1113542697 13:111121499-111121521 TGGGGGCTGTGAGGTGAGTGGGG + Intronic
1113802983 13:113096100-113096122 CTGGGGCCGAGAGCTGTGTGTGG + Intronic
1113812489 13:113151030-113151052 CTCGTCCTGGGAGGTGTGGGAGG + Intergenic
1114254676 14:20991339-20991361 CAGGTACTGTGAGGTGTGCAGGG - Intronic
1114573524 14:23692729-23692751 CTGGAGCTGGGGGGTGTCTGGGG - Intergenic
1118159628 14:63275512-63275534 CTGGTGCTCTGGGGTGACTGTGG - Intronic
1118347097 14:64948341-64948363 CTGGTGCTGAGTCCTGTGTGGGG - Exonic
1119625219 14:76168453-76168475 ATGGGGCTGTGAGTTGTCTGTGG + Intronic
1121017570 14:90557730-90557752 CTGGTGCTGCCTGGGGTGTGGGG + Intronic
1122243265 14:100383276-100383298 CGGGGGCTGTGAAGTGTGCGCGG + Intronic
1122322045 14:100861122-100861144 AGGGTGCTGGCAGGTGTGTGGGG - Intergenic
1122687068 14:103514107-103514129 CTGCTGCTGTGACTTGGGTGGGG + Intergenic
1122782734 14:104150435-104150457 CTGGGACTGTGGGGAGTGTGAGG + Intronic
1123926338 15:25115395-25115417 CTGGTTCCATGAGGGGTGTGGGG - Intergenic
1124078933 15:26473370-26473392 CTGGCAGTGTGAGCTGTGTGAGG - Intergenic
1124142240 15:27087854-27087876 AATGTGCTGTGGGGTGTGTGTGG + Intronic
1125002227 15:34783653-34783675 GTGGTGCTGTTAGTTGTTTGTGG - Intergenic
1125476374 15:40050645-40050667 GTGGTTGTGTGTGGTGTGTGGGG + Intergenic
1126436481 15:48644018-48644040 CTGGTTTTTTGAGTTGTGTGGGG - Intronic
1127790496 15:62394216-62394238 GTGGTGTTGTGATGTGTGTGTGG + Intronic
1128264731 15:66255794-66255816 ATAGTACTGTGAGCTGTGTGAGG + Intergenic
1128534578 15:68480942-68480964 CTGGTGCTTTTTGGTGTGGGTGG + Intergenic
1128547875 15:68579646-68579668 CTGGTGCTGAGCAGTGGGTGTGG + Intronic
1129264318 15:74385835-74385857 CTGGTGCTGCCAGATGTCTGAGG - Intergenic
1129653423 15:77507357-77507379 CTGCTTCTGGGAGGGGTGTGGGG - Intergenic
1129877829 15:78988365-78988387 CTGGTGCTGTAAGGTGTGGTTGG + Intronic
1129923133 15:79337737-79337759 CTGCTCCTGGGAGCTGTGTGAGG + Intronic
1129934556 15:79438141-79438163 CTGGTAGTGTGTGGAGTGTGGGG + Intronic
1129934601 15:79438304-79438326 CTGGTAGTGTGTGGAGTGTGGGG + Intronic
1130324992 15:82872667-82872689 GTGGCACTGTGAGGTGTGTGAGG - Intronic
1132715967 16:1289954-1289976 CTGGTGCTGGGGGGTCAGTGGGG - Intergenic
1132720364 16:1312655-1312677 CTGCGGCTGCGAGGTGTGTGAGG + Intronic
1134056328 16:11172416-11172438 CTGGAGCTCAGAGGTGTGAGTGG - Intronic
1134073005 16:11272278-11272300 CTGGTGCTTGGAGGACTGTGAGG + Intronic
1134901979 16:17946536-17946558 CTTCTGCTGTGCTGTGTGTGTGG + Intergenic
1135182219 16:20285519-20285541 TAGGTGCTGTGGGGTATGTGAGG + Intergenic
1136032531 16:27514147-27514169 CTGATGCTGTGAGGAGTGGAGGG - Intronic
1136115013 16:28089027-28089049 GTGGGGGTGTGGGGTGTGTGGGG - Intergenic
1136620283 16:31423946-31423968 CTGGGTCCGCGAGGTGTGTGGGG + Exonic
1136945637 16:34648109-34648131 TGTGTGCTGTGAGGTCTGTGAGG - Intergenic
1137691623 16:50432013-50432035 CTGATTCTGTGGGGAGTGTGGGG + Intergenic
1137692765 16:50440997-50441019 CTGGTGCTGGGAGGAGCTTGGGG + Intergenic
1137744021 16:50807768-50807790 CTGCTGCTGTTACCTGTGTGAGG + Intergenic
1138505278 16:57475385-57475407 ATGGTGGTGTGGTGTGTGTGGGG - Intronic
1138598788 16:58043152-58043174 CTGGGGCTGAGGGGTGTGTGCGG - Intronic
1139383341 16:66548476-66548498 CTGGGGCTGTGACTAGTGTGAGG - Intronic
1139602250 16:67993751-67993773 CTGGTGCTGGGTTGTGTGGGTGG + Exonic
1141072893 16:80974090-80974112 CTGGGGAGGTGAAGTGTGTGTGG - Exonic
1141459113 16:84166726-84166748 CTGGTGCTGGCAGGTAGGTGAGG - Intronic
1141518984 16:84564980-84565002 CTGGTGCTGTGGCTTGTGAGGGG - Intergenic
1141686910 16:85575440-85575462 CTGGTGCTGTGTGCCCTGTGGGG + Intergenic
1141973975 16:87501703-87501725 CTGGTGTTTTGAGGTAGGTGGGG + Intergenic
1142238323 16:88933311-88933333 GTGGCACTGTGAGGCGTGTGAGG - Intronic
1142238328 16:88933374-88933396 GTGGCACTGTGAGGCGTGTGAGG - Intronic
1142238333 16:88933437-88933459 GTGGCACTGTGAGGCGTGTGAGG - Intronic
1142238338 16:88933500-88933522 GTGGCACTGTGAGGCGTGTGAGG - Intronic
1142238343 16:88933563-88933585 GTGGCACTGTGAGGCGTGTGAGG - Intronic
1142238348 16:88933626-88933648 GTGGCACTGTGAGGCGTGTGAGG - Intronic
1142238353 16:88933689-88933711 GTGGCACTGTGAGGCGTGTGAGG - Intronic
1142238358 16:88933752-88933774 GTGGCACTGTGAGGCGTGTGAGG - Intronic
1142311098 16:89314345-89314367 CGTGTGCTGTGAGGGATGTGTGG - Intronic
1142343052 16:89536595-89536617 CAGGTGAGGTGAGGTGGGTGAGG + Intronic
1142866394 17:2794181-2794203 CTGGGGCTGTGGAGAGTGTGGGG - Intronic
1142978740 17:3659605-3659627 CTGGAGCTGTGAGGTGTGGGGGG + Intronic
1143318097 17:6047944-6047966 CTGGTGCTCTGAGGAGACTGTGG + Intronic
1143562937 17:7705831-7705853 CTGGTGCTCTGATGTGTGATGGG + Intronic
1143564370 17:7712468-7712490 CTGGGGCAGGGTGGTGTGTGAGG + Intergenic
1143616361 17:8052479-8052501 CTAGGGTTGTGTGGTGTGTGTGG - Intergenic
1143639524 17:8188231-8188253 CTGGTGCTGGGAGTGGGGTGGGG - Intergenic
1143846025 17:9773136-9773158 CTGGTGGTGTGATGTGATTGTGG + Intronic
1144738148 17:17566388-17566410 CTGGTGCTGTGAGGCATGGATGG - Intronic
1144781970 17:17812916-17812938 CTGGTGCCGTGGCTTGTGTGTGG - Intronic
1145371673 17:22311476-22311498 CTGGTGGTGAGAGGAGTGGGTGG + Intergenic
1145792995 17:27639350-27639372 CTGGTGCTGGGGGGTGGGGGAGG - Intronic
1145807850 17:27747167-27747189 CTGGTGCTGGGAGGTAGGGGAGG - Intergenic
1146469133 17:33110523-33110545 CTGGCGCAGTGACATGTGTGTGG + Intronic
1146624115 17:34423104-34423126 CTGGTTATGTGGGGTCTGTGAGG - Intergenic
1147264019 17:39224527-39224549 CTGGCGCTGAAAGGGGTGTGGGG - Intronic
1147366631 17:39963413-39963435 CTGCTGCTGTGAAGTGCCTGTGG + Intronic
1147582163 17:41633514-41633536 CTGGGAGTGTGAGGTGTGAGTGG + Intergenic
1147664799 17:42139792-42139814 CTGTGGCTGGGACGTGTGTGTGG - Intronic
1148383970 17:47221397-47221419 CTGGTGCTTAGAGGTCTGGGTGG + Intronic
1148496204 17:48054801-48054823 CTGGGGTTGTGAGGTGGGAGGGG + Intronic
1148560058 17:48601018-48601040 GTGGTGTGGTGTGGTGTGTGTGG + Intronic
1148748840 17:49932986-49933008 CTGGAGGGGTGAGGGGTGTGGGG - Intergenic
1148751087 17:49946314-49946336 CTGAGGCAGGGAGGTGTGTGAGG - Intergenic
1150291520 17:63985078-63985100 TTTGTGCTGGGAGCTGTGTGTGG + Intergenic
1150692307 17:67377282-67377304 CTGGGGCCGGGAGGTGGGTGCGG - Intronic
1151145276 17:72034687-72034709 CTATGGATGTGAGGTGTGTGAGG - Intergenic
1151241350 17:72760736-72760758 CTGGTTCTGAGATGTCTGTGGGG - Intronic
1151534808 17:74732782-74732804 TGTGTGGTGTGAGGTGTGTGTGG + Intronic
1152094705 17:78266379-78266401 CTGGTCCTCCCAGGTGTGTGTGG + Intergenic
1152330820 17:79671558-79671580 CTGGTGCTGGGAGGGGCCTGAGG - Intergenic
1153503868 18:5775077-5775099 CTGGGGCAGTGAGGGGAGTGGGG - Intergenic
1154080098 18:11247987-11248009 TGTGTGGTGTGAGGTGTGTGTGG - Intergenic
1154168747 18:12035672-12035694 CTGGAGATGTGAGGGGGGTGGGG + Intergenic
1154253895 18:12766655-12766677 CGGGTGCTGCGTGGTGTGTCGGG - Intergenic
1157602485 18:48902473-48902495 CTGGCTCTGTTAGGTGTGTGGGG - Intergenic
1157701034 18:49761699-49761721 GTGGGGATGTGGGGTGTGTGGGG - Intergenic
1159955638 18:74516623-74516645 CTGGAGCCTTGAGGTGAGTGAGG - Intronic
1160415099 18:78704332-78704354 GGTGTGCTGTGTGGTGTGTGTGG + Intergenic
1160484694 18:79279055-79279077 CTGGAGCCGACAGGTGTGTGGGG + Intronic
1160566029 18:79787263-79787285 TAGGTGCTGAGAGGTGTGAGGGG + Intergenic
1160756279 19:758521-758543 CTGGGGCTGGGAGGTGGCTGGGG + Exonic
1160858564 19:1228097-1228119 CTGTGGCTGTGAGGGGTGTTTGG + Exonic
1161477163 19:4493196-4493218 CTGTGTCTGTGCGGTGTGTGTGG + Intronic
1161706656 19:5825270-5825292 CAGGTGCTGTGGGGTGAGGGTGG + Intronic
1161992333 19:7691056-7691078 CTCTAGCTGTGAGGTGTCTGTGG - Intronic
1162320323 19:9967841-9967863 CTGGTGCAGTGAAGGGGGTGGGG + Intronic
1162320955 19:9970378-9970400 CGGGGGCTGTGGGGTGAGTGGGG + Intronic
1163149452 19:15402354-15402376 CTGTGCCTGTGAGGTGTGTGGGG - Intronic
1163289360 19:16369441-16369463 CCTGCCCTGTGAGGTGTGTGAGG + Intronic
1163600396 19:18245789-18245811 CTGATGCTGTGAGCTGAGTGTGG + Intronic
1164977295 19:32582594-32582616 CAGGTGCTGTGCGCTGTGTTGGG - Intronic
1165637523 19:37354605-37354627 ATGGTGCAGTGAGTTGTATGTGG + Intronic
1166390614 19:42407052-42407074 CAGGAGCTGGGAGGTGTGGGGGG + Intronic
1167033884 19:46981674-46981696 CTGCTCCTGGGAGGTGTCTGTGG - Intronic
1167157949 19:47750654-47750676 GTGGTGGTGTGAGGTGCCTGGGG + Intronic
1167488253 19:49776066-49776088 CTGTTGCCGTGAGGGGTGTTCGG - Intronic
1167998365 19:53425233-53425255 CTGCTGCAGTGCGGTGTGGGTGG - Intronic
925016273 2:526772-526794 TGTGTGCTGTGTGGTGTGTGGGG + Intergenic
925016282 2:526877-526899 TGTGTGCTGTGTGGTGTGTGTGG + Intergenic
925731867 2:6924772-6924794 AGTGTGCTGTGAAGTGTGTGAGG + Intronic
925761040 2:7184733-7184755 CAGGTGTTGTGAGGTGGTTGTGG - Intergenic
925815826 2:7747800-7747822 CTGGTGCTGTTGGGTGATTGGGG + Intergenic
925817510 2:7767920-7767942 GTGTCTCTGTGAGGTGTGTGTGG - Intergenic
927148862 2:20184463-20184485 CTGGTGCTTTGAGGAGGGTGGGG + Intergenic
927151277 2:20197880-20197902 CTGGTGGTGGGAGGTGGGTGTGG + Intergenic
928545032 2:32321771-32321793 CTGTTGCTGTCAGGTGTGTCAGG - Intergenic
929457437 2:42075822-42075844 CTGGTCCTAGGTGGTGTGTGTGG + Intergenic
931768171 2:65475244-65475266 CTGGTACTGTGAGCTCAGTGGGG + Intergenic
932485441 2:72081696-72081718 CTGCTGCTCTGAGATTTGTGGGG + Intergenic
932620915 2:73264564-73264586 CTGGTGTGGGGATGTGTGTGGGG + Intronic
933609167 2:84416049-84416071 CAGGAGCTGTGAGAGGTGTGAGG + Intergenic
934047825 2:88186702-88186724 GTGGTGGGCTGAGGTGTGTGCGG + Intergenic
935723373 2:105999272-105999294 TTGGTGCTGTGCTGTGTCTGCGG + Intergenic
935921383 2:108019196-108019218 CTGGTGCTGCTAGGTGGGGGAGG - Intergenic
935960819 2:108423999-108424021 GTGTGGCTGTGAGGTGTGGGAGG - Intergenic
936351348 2:111715024-111715046 CTGGTGTGGTGAAGTGGGTGAGG + Intergenic
937295544 2:120807850-120807872 CGGGGGCGGGGAGGTGTGTGGGG - Intronic
937466647 2:122138778-122138800 CTGGTGCTGGCAGGTGGGAGGGG - Intergenic
937884234 2:126889252-126889274 CTGCTGCTGTGGGGAGAGTGTGG - Intergenic
938399482 2:130977070-130977092 GTGTTACTGTGTGGTGTGTGTGG + Intronic
942481538 2:176393383-176393405 TGGGAGCTGTGAGGTGCGTGGGG + Intergenic
944284315 2:197931279-197931301 ATGCTGCTCTGAGGTGGGTGAGG - Intronic
944677344 2:202044709-202044731 GTGGTGGTGTGTGGTATGTGTGG + Intergenic
944960301 2:204864762-204864784 CTGGTGCTTAGAGGAGTGTCTGG + Intronic
945955337 2:216081579-216081601 CTGGTGCAGAGAGGTGGCTGTGG - Intronic
947375472 2:229490797-229490819 CTGGTGTGCTGAGGTGTGAGTGG - Intronic
947856642 2:233328665-233328687 CTGGTGAAGAGAGGGGTGTGGGG - Intronic
948367237 2:237464933-237464955 GTGGTTGTGTGTGGTGTGTGCGG + Intergenic
948460841 2:238129229-238129251 CAGGTGCCGGCAGGTGTGTGGGG + Intronic
948544063 2:238713378-238713400 TGTGTGCTGTGTGGTGTGTGTGG - Intergenic
948605011 2:239129436-239129458 GTGGTGCTGGGCGGGGTGTGGGG + Intronic
948809941 2:240469325-240469347 CTGGTGGTCTGAGGTGTGGCCGG - Intergenic
948993424 2:241565686-241565708 CTAGTGTTGTGAGCCGTGTGAGG + Intronic
949044446 2:241866027-241866049 CTTGTAGTGTGTGGTGTGTGTGG + Intergenic
1169392716 20:5203358-5203380 CTTCTGCTGTGAGGTGGGAGTGG - Intergenic
1170194838 20:13679408-13679430 CTGGTGGTGGGAGGTGGGGGTGG + Intergenic
1170779232 20:19409021-19409043 CTGGTGCTTTGATGTGTTTCTGG - Intronic
1171380847 20:24732895-24732917 CTGCTGCTCTGAGGAGTGTAGGG + Intergenic
1171428978 20:25067265-25067287 GTGGTTGTGTGTGGTGTGTGTGG - Intergenic
1171854525 20:30332454-30332476 CTGGTGAGGTCAAGTGTGTGTGG + Intergenic
1172620416 20:36315149-36315171 TGTGTGCTGTGATGTGTGTGTGG + Intronic
1174127236 20:48315596-48315618 CTGGTGGGGTGTGGGGTGTGGGG + Intergenic
1174338439 20:49881196-49881218 ATGGTGCTATGAAGTGGGTGAGG + Intronic
1175089075 20:56486902-56486924 CTGGTCCTGTCAGGACTGTGGGG + Intronic
1175310649 20:58009433-58009455 CTGGAACTGTGAGATGGGTGAGG - Intergenic
1175909065 20:62395987-62396009 GTGTGGCTGTGAGATGTGTGGGG - Intronic
1176372405 21:6070121-6070143 GTGGTTGTGTGAGGTATGTGGGG + Intergenic
1177394578 21:20515631-20515653 CTGGCGCTGTGAGATGGGAGAGG + Intergenic
1177513312 21:22117807-22117829 CTGGTGATTTCATGTGTGTGTGG - Intergenic
1178264709 21:31132340-31132362 CAGATGCTGTGAGGTGTGAAGGG - Intronic
1178804240 21:35825152-35825174 CTGGAGGTGTGAGATGTGAGTGG + Intronic
1179105384 21:38395914-38395936 GTGGCGGTGTGGGGTGTGTGGGG - Intronic
1179333025 21:40423874-40423896 CGGAGGCTGTGAGGGGTGTGGGG + Intronic
1179751113 21:43468418-43468440 GTGGTTGTGTGAGGTATGTGGGG - Intergenic
1179824936 21:43958711-43958733 TTTGTGATGTGTGGTGTGTGTGG + Intronic
1179824943 21:43958822-43958844 TTTGTGATGTGTGGTGTGTGTGG + Intronic
1180197907 21:46208444-46208466 CTGGTGCTGCGAGGCGCGCGAGG + Intronic
1180219547 21:46349525-46349547 CTGGTGCTATCAGGCATGTGAGG + Intronic
1180287265 22:10759710-10759732 CTGGTGCATTCAGGTGTGGGAGG - Intergenic
1180565305 22:16658834-16658856 CTGGTGCTGCAAGGTGGCTGGGG + Intergenic
1181494742 22:23281547-23281569 CTGGTGCTGTGTGGGCTGGGAGG + Intronic
1182056367 22:27358450-27358472 CTGGTGCTCAGAAGTGTTTGTGG - Intergenic
1182210739 22:28675216-28675238 TGTGTGGTGTGAGGTGTGTGTGG - Intronic
1183050313 22:35255631-35255653 CTGGTCCTTTGACGTGTCTGTGG - Intergenic
1184037945 22:41927290-41927312 TGGGTGCTGGGAGGTGTCTGGGG + Intergenic
1184330318 22:43823106-43823128 AAGGTGCTGTGAGGACTGTGAGG - Intergenic
1184688683 22:46107779-46107801 CACGTGTTGTGGGGTGTGTGCGG - Intronic
1184776619 22:46626591-46626613 GTGGGGCTTGGAGGTGTGTGTGG + Intronic
1184840207 22:47048179-47048201 CTGCTGCTGAGAGGTGTGTGTGG + Intronic
1185351020 22:50338586-50338608 TTTGTGGTGTGTGGTGTGTGTGG + Intergenic
1185351137 22:50339749-50339771 GTGGTGGTGTGTGGTGTGTGTGG + Intergenic
1203290522 22_KI270735v1_random:32698-32720 TGTGTGCTGTGAGGTCTGTGGGG + Intergenic
1203323379 22_KI270737v1_random:90719-90741 TGTGTGCTGTGAGGTCTGTGGGG + Intergenic
949788382 3:7766468-7766490 TGGGTTCTGTGAGATGTGTGGGG - Intergenic
950136829 3:10586982-10587004 CTGGTGGTGCTAAGTGTGTGAGG - Intronic
950282522 3:11719852-11719874 CTGGGGCAGTGAGGTTTGTCGGG + Intronic
952959349 3:38579901-38579923 CTGGGTGTGTGTGGTGTGTGTGG - Intronic
953446868 3:42975912-42975934 CTGGTGCAGGGAGGTATGTCAGG + Intronic
953786825 3:45917309-45917331 GTGGGGGTGTGAGGTGAGTGTGG + Intergenic
954211384 3:49099500-49099522 CTGGTGCTGTGCGGTAGGTGCGG - Exonic
954445286 3:50543012-50543034 GTGGAGCTGGGAGGTGGGTGCGG + Intergenic
954848144 3:53577711-53577733 CTGGAGATGTGAGGGCTGTGAGG + Intronic
954932272 3:54294556-54294578 CTGGTGGTGTGGGGAGTGTGTGG + Intronic
955195577 3:56802076-56802098 CTGGGGCTGCGAGGGGCGTGGGG + Intronic
956643729 3:71436396-71436418 CTTGTGGTCTGAGGAGTGTGGGG + Intronic
956771917 3:72534169-72534191 GTGGTTGTGTGTGGTGTGTGTGG + Intergenic
957335122 3:78818275-78818297 CTGGTACTGTGGGGATTGTGAGG + Intronic
958486595 3:94719712-94719734 CAGTAGCTGTGAGGTGTGTTGGG - Intergenic
958963649 3:100534904-100534926 GTGCATCTGTGAGGTGTGTGAGG - Intronic
959570365 3:107876578-107876600 CTGGGGCTGGGAGCTGGGTGGGG + Intergenic
959636792 3:108583602-108583624 GTGGTGATGGGAGGTGTGAGGGG + Intronic
961007553 3:123415063-123415085 CTGGTGATGTGGGGTGGCTGTGG - Intronic
961466201 3:127083130-127083152 CTGGTGCTGTGATGTGGGCAGGG - Intergenic
961516716 3:127442577-127442599 CTGGTGCTGAGTGGTGCTTGGGG - Intergenic
962736272 3:138328344-138328366 CTGGGGGTGGGAGGGGTGTGGGG - Intronic
962977355 3:140457183-140457205 CCGGTGCAGAGATGTGTGTGTGG - Intronic
964544591 3:157819979-157820001 CTGGTGCTGTGTGTACTGTGTGG - Intergenic
965415315 3:168385219-168385241 CTGCTGCTGGGAGGTGGGAGAGG + Intergenic
965699985 3:171450821-171450843 CTGGTGCTTTGAACTGTGTCTGG - Intronic
966715914 3:183012731-183012753 CATGTGCGGTGAGGTGAGTGAGG - Intergenic
967089744 3:186125441-186125463 ATGGTGGTGTGTGGTGTGGGGGG + Intronic
967766735 3:193289109-193289131 CTGGTGCTCTGTGGAGTGAGGGG + Intronic
967884923 3:194326577-194326599 GTGGTTGTGTGTGGTGTGTGTGG - Intergenic
967884962 3:194327080-194327102 GTGGTTGTGTGTGGTGTGTGTGG - Intergenic
967885014 3:194327618-194327640 GTGGTTGTGTGTGGTGTGTGTGG - Intergenic
968089991 3:195893657-195893679 CTGCAGCTGTCAGGTGTGTCTGG - Intronic
968668476 4:1834523-1834545 CTGATGGTGTGAGGTGTGGGTGG - Intronic
968949645 4:3683918-3683940 CTGATGCTGTGAGAGGTTTGAGG - Intergenic
969884227 4:10200969-10200991 CAGTGGCTGTGAGGTGGGTGTGG + Intergenic
969924900 4:10576391-10576413 CTGGAGCTGTCTGGTGTCTGTGG - Intronic
970136218 4:12927314-12927336 CTGCTGCTAGGAGGTGTGTTGGG - Intergenic
972287722 4:37664857-37664879 CTGTTGTAGTGAGGTGGGTGGGG - Intronic
973567140 4:52199850-52199872 GTGGGGGTGTGTGGTGTGTGTGG + Intergenic
973567145 4:52199869-52199891 GTGGGGGTGTGTGGTGTGTGTGG + Intergenic
975696786 4:77021606-77021628 CAGGTGGTGTGAGGTGTGTCTGG + Intronic
975983426 4:80183684-80183706 GTGGTGTGGGGAGGTGTGTGAGG - Intergenic
979113879 4:116796239-116796261 GTGGTGCTCTGAGGTGTGTGAGG - Intergenic
979806941 4:124985544-124985566 CTGGGGCAGTGAGCTGAGTGAGG + Intergenic
981937428 4:150251383-150251405 TGGGGGGTGTGAGGTGTGTGGGG - Intronic
982301248 4:153881355-153881377 CAGCTGGTGTGAGGTGTCTGAGG - Intergenic
984634221 4:182093448-182093470 CTTGTACTCTGATGTGTGTGGGG - Intergenic
985070282 4:186160735-186160757 GTGGTGTGGTGTGGTGTGTGTGG - Intronic
985938441 5:3114458-3114480 CTGGTGCTGCCACGTGTGTGGGG + Intergenic
986111049 5:4718104-4718126 CGTGAGCTCTGAGGTGTGTGTGG + Intergenic
986144721 5:5066504-5066526 CTGGTGCTGCTAGTTGTCTGGGG + Intergenic
986269295 5:6217363-6217385 CTGATGCTGTGAGGTCAGTTAGG + Intergenic
990001916 5:50903564-50903586 TTGGTGCTGTCAGGCGAGTGAGG - Intergenic
992079161 5:73217795-73217817 CTGGTGCTTTGAGATGGGAGAGG + Intergenic
995650933 5:114367266-114367288 CTGGTGCACTGAGCTGTCTGTGG - Intronic
995946116 5:117648365-117648387 CTGGTGCCTGGAGGTGGGTGGGG - Intergenic
997145543 5:131429091-131429113 CTGGAGGTTTTAGGTGTGTGTGG + Exonic
997396541 5:133564536-133564558 CTAGAGCTGTGAGGAATGTGGGG + Intronic
1000254872 5:159527846-159527868 CTAGTGGTGTGATGTGGGTGGGG + Intergenic
1001924710 5:175627781-175627803 CCTGGGCTGTGAGCTGTGTGTGG - Intergenic
1002133180 5:177093549-177093571 CAGGTGCGCTGAGCTGTGTGGGG + Exonic
1002341900 5:178522384-178522406 CTGTTGCTGTGATGTCTGTGCGG - Intronic
1002554357 5:180023483-180023505 CTGGTGCTGTAAGATGTGCCAGG - Intronic
1003079569 6:3010451-3010473 CTGGTGCTGGGTAGTTTGTGGGG - Intronic
1003147260 6:3518784-3518806 CTGCTGCTGACAGCTGTGTGCGG - Intergenic
1003463386 6:6353042-6353064 CAGGTGGTGTGCGGTGTGTGTGG - Intergenic
1003948266 6:11094377-11094399 CTGATGGTGTGCGGTGAGTGGGG + Exonic
1005281286 6:24277270-24277292 GTGGTGGGGTGGGGTGTGTGAGG + Intronic
1005590312 6:27318015-27318037 CTGGTGCTGTGAACTCTGAGAGG + Intergenic
1005841718 6:29748373-29748395 CTGCTGCTGTGGGGACTGTGGGG - Intergenic
1006058752 6:31404212-31404234 CTGCTGCTGTGGGGACTGTGGGG + Intronic
1006132826 6:31879044-31879066 GTGGGGCTGTGACGTGTGGGAGG - Intronic
1006735336 6:36269233-36269255 CTGTTGCTGTGTGGTCTTTGAGG + Intronic
1007914434 6:45547749-45547771 CTGGTTTTGTGAGCTGTCTGCGG - Exonic
1008902603 6:56638740-56638762 CTGGTTTTGTGAGGTGTATTGGG - Intronic
1011552906 6:88546421-88546443 GTGGTGTTGTCAGGGGTGTGGGG - Intergenic
1011626882 6:89290392-89290414 CTGGTCCTGAGAGGTGGCTGAGG - Intronic
1013759557 6:113500799-113500821 CTGGTGCTGTGAGCTTCTTGAGG + Intergenic
1013836434 6:114341635-114341657 GTGGGGCTGTGAGGGGTGTGGGG + Intronic
1015452121 6:133382259-133382281 CTGCTGCTGTAAAGTGTGGGGGG + Intronic
1017889799 6:158628812-158628834 CAGGTGCTGTGAGGTAAATGAGG + Intronic
1018358859 6:163045290-163045312 CTATTCCTGTGAGGTGGGTGTGG - Intronic
1019073964 6:169371824-169371846 TGTGTGCTGTGTGGTGTGTGTGG - Intergenic
1019171299 6:170134707-170134729 CTGGGGCTTTGAGGGGTGGGAGG + Intergenic
1019304293 7:325553-325575 CTGGGGCCAGGAGGTGTGTGGGG - Intergenic
1019319688 7:409951-409973 ATGGTGCTTTGGTGTGTGTGAGG + Intergenic
1019740655 7:2671350-2671372 GTGGTGCTGTGAGTTGTGCTAGG + Intergenic
1020214545 7:6179738-6179760 GTGGGGGTGTGGGGTGTGTGTGG - Intronic
1021277854 7:18677135-18677157 CTGGGGCTGGGAGGAGAGTGAGG - Intronic
1022043141 7:26599794-26599816 CTGGGGAGGGGAGGTGTGTGAGG + Intergenic
1023079690 7:36515308-36515330 GTGGGGTTGTGAGGGGTGTGGGG - Intronic
1023079770 7:36515707-36515729 GTGTTGGTGTGTGGTGTGTGGGG - Intronic
1023630276 7:42156814-42156836 CTGGTGATGGGAGGAGGGTGTGG - Intronic
1024891543 7:54210162-54210184 CTGTGGCTGGGAGGTGGGTGAGG - Intergenic
1025757688 7:64360330-64360352 CTGGTGCAGTGGAGTGGGTGTGG + Intergenic
1026112033 7:67466085-67466107 TTGATGCTGTGAGGTTTGAGTGG - Intergenic
1026679149 7:72452119-72452141 CTGGTTATGTTAGGTGTGTTAGG + Intergenic
1027266752 7:76498800-76498822 GTGGAGGTGTGGGGTGTGTGGGG + Intronic
1027318334 7:76997754-76997776 CTGGAGGTGTGTGGGGTGTGTGG + Intergenic
1027318340 7:76997780-76997802 GTGGAGGTGTGGGGTGTGTGTGG + Intergenic
1027318415 7:76998140-76998162 GTGGAGTTGTGAGGTGTGGGTGG + Intergenic
1028656602 7:93215624-93215646 CTGGGGCTGTGGAGTATGTGGGG - Exonic
1029115246 7:98233352-98233374 CTGGGGGTGTGGGGTGTGGGAGG - Intronic
1031341539 7:120608757-120608779 CAGGTGTTTTGAGGTGTTTGAGG - Intronic
1032395596 7:131587325-131587347 GTGGTGCTGCAATGTGTGTGTGG + Intergenic
1032395614 7:131587572-131587594 GTGGTGCTGCAATGTGTGTGTGG + Intergenic
1033089457 7:138371699-138371721 CTGGTGCTGCTAGGTGGGAGTGG - Intergenic
1033486404 7:141793154-141793176 CTGTCACTGTGAGTTGTGTGAGG + Intergenic
1033499720 7:141935763-141935785 CTGAGGCTGTGTGGAGTGTGTGG + Intronic
1033508418 7:142029554-142029576 CTAGTGGTGTGAGATGTGAGAGG + Intronic
1034434327 7:151055945-151055967 CAGGTGCTGAAAGGTGGGTGGGG - Intronic
1034611406 7:152373313-152373335 CTGGTGCTGTTAGGTGTTGGGGG - Intronic
1035032507 7:155870604-155870626 CAGGTGCTGTGTGGTGTTTCAGG - Intergenic
1035233587 7:157482354-157482376 CGTGTGGTGTGTGGTGTGTGTGG + Intergenic
1035284680 7:157798813-157798835 CTGGTGCTGTGGGGTGGGGTGGG + Intronic
1035293551 7:157854901-157854923 CTGTTGCAGGGATGTGTGTGGGG + Intronic
1035309200 7:157954164-157954186 TGTGTGCTGTGTGGTGTGTGTGG + Intronic
1035309214 7:157954319-157954341 TGTGTGCTGTGTGGTGTGTGTGG + Intronic
1035577873 8:719493-719515 CAGGTGCTGTGAGGTCTGCTGGG + Intronic
1035631299 8:1108561-1108583 CTGGGTCTGTGAGGTGTGCACGG + Intergenic
1035631309 8:1108655-1108677 CTGGGTCTGTGAGGTGTGCACGG + Intergenic
1035631329 8:1108842-1108864 CTGGGTCTGTGAGGTGTGCACGG + Intergenic
1035631341 8:1108952-1108974 CTGGGTCTGTGAGGTGTGTACGG + Intergenic
1035631353 8:1109064-1109086 CTGGGTCTGTGAGGTGTGCACGG + Intergenic
1035631363 8:1109139-1109161 CTGGATCTGTGAGGTGTGCACGG + Intergenic
1035631372 8:1109214-1109236 CTGGATCTGTGAGGTGTGCACGG + Intergenic
1035631381 8:1109289-1109311 CTGGATCTGTGAGGTGTGCACGG + Intergenic
1035631390 8:1109364-1109386 CTGGATCTGTGAGGTGTGCACGG + Intergenic
1035631403 8:1109474-1109496 CTGGGTCTGTGAGGTGTGTACGG + Intergenic
1035631411 8:1109530-1109552 CTGGGTCTGTGAGGTGTGCACGG + Intergenic
1035631432 8:1109715-1109737 CTGGGTCTGTGAGGTGTGTACGG + Intergenic
1035631440 8:1109771-1109793 CTGGGTCTGTGAGGTGTGCACGG + Intergenic
1035631461 8:1109956-1109978 CTGGGTCTGTGAGGTGTGTACGG + Intergenic
1035631489 8:1110199-1110221 CTGGATCTGTGAGGTGTGCATGG + Intergenic
1035631493 8:1110236-1110258 CTGGATCTGTGAGGTGTGCACGG + Intergenic
1035631497 8:1110273-1110295 CTGGATCTGTGAGGTGTGCACGG + Intergenic
1035631502 8:1110310-1110332 CTGGGTCTGTGAGGTGTGCACGG + Intergenic
1035631511 8:1110390-1110412 CTGGATCTGTGAGGTGTGCATGG + Intergenic
1035649285 8:1252996-1253018 CTGGTGCTGGGAGGCCTGTGGGG - Intergenic
1035700715 8:1637824-1637846 TGGGTGCTGTGAGATGTGTGTGG + Intronic
1035898630 8:3433464-3433486 TTGGTGTTGTGTGGTGTGGGCGG + Intronic
1036459008 8:8935518-8935540 CTGTTGCTGTGCTGCGTGTGTGG + Intergenic
1036640869 8:10582681-10582703 TGGGAGCTGTGAGGTGTGTAGGG + Intergenic
1038324788 8:26564661-26564683 CAGCTGCTGAGAGGTGTGAGAGG + Intronic
1039032416 8:33324745-33324767 ATGGTGCTGTGAGATGGGGGAGG - Intergenic
1039602555 8:38852789-38852811 CGGGTGCCATGAAGTGTGTGAGG + Exonic
1039947304 8:42140810-42140832 GTGGTGCTGTTGGGTGTGAGGGG - Intergenic
1040373865 8:46803766-46803788 CTGGTGCAGTGGAGTGGGTGTGG + Intergenic
1040520751 8:48174137-48174159 ATGGTGGTGTGTGGTGTGTGTGG + Intergenic
1040520752 8:48174156-48174178 GTGGTGCAGTGCGATGTGTGCGG + Intergenic
1041118408 8:54563132-54563154 CTTCTGCTCTGAGGTGTGGGGGG - Intergenic
1043733236 8:83711879-83711901 ATGGTGCCATGAAGTGTGTGAGG + Intergenic
1045187445 8:99853517-99853539 CTGATGCTTTGTGGTGGGTGAGG - Exonic
1045326128 8:101119062-101119084 CTTGTGCTGTGAGGTGCCTGGGG - Intergenic
1046618137 8:116499800-116499822 CTGGTGCTGTGTGCAGTCTGGGG - Intergenic
1047119538 8:121885658-121885680 CCTGTGCTGAGAGTTGTGTGAGG - Intergenic
1047224862 8:122947759-122947781 GAGGTGCTGTGAGGGGAGTGAGG + Intronic
1047733780 8:127748206-127748228 CTGGAGCTCTCAGCTGTGTGTGG + Intergenic
1048307675 8:133295487-133295509 CCGGTTCTGTGTGGTGTGTGTGG - Intronic
1048321645 8:133404924-133404946 GGGGTGGTGTGTGGTGTGTGTGG - Intergenic
1049372981 8:142276499-142276521 CTGTTGCTGAGAGGTGAATGTGG + Intronic
1049757039 8:144315369-144315391 CTGGTGGTGTGAGGGGAGGGTGG - Exonic
1049798724 8:144508128-144508150 ATGAGGCTGTGAAGTGTGTGTGG - Intergenic
1050484082 9:6115341-6115363 ATGGAGCAGTAAGGTGTGTGTGG - Intergenic
1051822273 9:21181735-21181757 CTGGTGATGTGACGGGTGGGTGG - Intergenic
1051823504 9:21193793-21193815 CTGGTGATGTGAGGGGTGGATGG - Intergenic
1051825326 9:21212331-21212353 CTGGTGATGTGAGGGGTGGGTGG - Intronic
1053285548 9:36847657-36847679 CAGGAGCTGTGAGGTGTGCCAGG + Intronic
1053790573 9:41683505-41683527 CAGATGATGTGAGGTGGGTGGGG - Intergenic
1053792343 9:41695734-41695756 CTGGTGAGGTCAAGTGTGTGTGG + Intergenic
1054154587 9:61631296-61631318 CAGATGATGTGAGGTGGGTGGGG + Intergenic
1054178918 9:61895204-61895226 CAGATGATGTGAGGTGGGTGGGG - Intergenic
1054180752 9:61907754-61907776 CTGGTGAGGTCAAGTGTGTGTGG + Intergenic
1054408957 9:64789902-64789924 TGTGTGCTGTGAGGTCTGTGGGG + Intergenic
1054472605 9:65550234-65550256 CTGGTGAGGTCAAGTGTGTGTGG - Intergenic
1054474361 9:65562372-65562394 CAGATGATGTGAGGTGGGTGGGG + Intergenic
1054656839 9:67673388-67673410 CTGGTGAGGTCAAGTGTGTGTGG - Intergenic
1054658619 9:67685627-67685649 CAGATGATGTGAGGTGGGTGGGG + Intergenic
1056255319 9:84793519-84793541 CTGAGGCAGTGAGGTGTTTGTGG - Intronic
1056756201 9:89383454-89383476 CTGGTGTTTTGTGGTGTGTCTGG - Intronic
1056852913 9:90099008-90099030 TGGGTGGTGTGATGTGTGTGTGG - Intergenic
1057547976 9:96032189-96032211 CTGATGAAGGGAGGTGTGTGGGG - Intergenic
1059505881 9:114799595-114799617 CTGGGGATGTGAAGTGGGTGGGG - Intronic
1059577216 9:115503430-115503452 CTGGTGGTATGAAGCGTGTGTGG + Intergenic
1060517164 9:124273126-124273148 CCAAGGCTGTGAGGTGTGTGGGG + Intronic
1060954541 9:127629210-127629232 CTGGAGCTGTGGGGAGTGTGTGG + Intronic
1061177802 9:129008145-129008167 CTTGAGCTGTGAGGGGTGGGAGG + Exonic
1061524347 9:131146237-131146259 GTGGTGCTGAGAGAGGTGTGGGG - Exonic
1061957478 9:133971211-133971233 CTGCTGCTGTGAGGCCTGTCGGG + Intronic
1061974565 9:134061800-134061822 CTGGGGCTGTGGGGTGTTGGCGG - Intronic
1061995873 9:134182934-134182956 CATGTGGTGTGTGGTGTGTGTGG + Intergenic
1061995882 9:134183012-134183034 ATGGTGAGGTGTGGTGTGTGTGG + Intergenic
1061995889 9:134183065-134183087 ATGGTGAGGTGTGGTGTGTGTGG + Intergenic
1062040676 9:134402944-134402966 CTGGTGCTGTCAGCTGTGTGTGG - Intronic
1062141795 9:134963240-134963262 CTGGTGCTGTGAGCAGTGCCTGG - Intergenic
1062311604 9:135940925-135940947 GTGGTGCTGGGAGCTGTGTGGGG - Intronic
1062337922 9:136080628-136080650 CTGATTCTGTGCGGTCTGTGGGG - Intronic
1062378333 9:136275002-136275024 CAGCTGCTGTGAGGAGTGGGAGG + Intergenic
1186168177 X:6849090-6849112 CTGGAGCTGGGAAGTATGTGGGG + Intergenic
1186521193 X:10208363-10208385 CTGGTGCTCTGGCGTGTGTAGGG - Exonic
1186797268 X:13058942-13058964 CTGATGCTGGGAGATGGGTGAGG + Intergenic
1188734313 X:33693658-33693680 CAGATGCAGTGAGGTGTGTGTGG - Intergenic
1190054372 X:47173353-47173375 CTGGAGCTGTGAGGAGAGTGTGG - Intronic
1190542717 X:51495636-51495658 CTGCTTTTGGGAGGTGTGTGTGG - Intronic
1194212326 X:91083404-91083426 GTGGAGCAGTGAGGTGTGTGTGG - Intergenic
1196368983 X:114954172-114954194 CAGCTGCTGTGGGGTGTGTTGGG + Intergenic
1197096565 X:122603832-122603854 CTGCTGCTGTGTGGTGGGGGAGG - Intergenic
1197193393 X:123673793-123673815 CTGGTAGTGTGAGGCGTCTGAGG - Intronic
1197566922 X:128099587-128099609 CTGGTGCTGTCAGGGGGCTGGGG - Intergenic
1197851797 X:130870040-130870062 ATGGTGATTTGAGGTGAGTGGGG - Intronic
1201980488 Y:19903341-19903363 CAGGTCCTGTCAGGTGTTTGGGG + Intergenic
1202601681 Y:26600226-26600248 CTGGTGCTGCAAGGTGGCTGGGG + Intergenic