ID: 1075062302

View in Genome Browser
Species Human (GRCh38)
Location 10:119265641-119265663
Sequence CAGCTCAGGCTGCCATAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 4, 2: 0, 3: 14, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075062302_1075062307 23 Left 1075062302 10:119265641-119265663 CCAGTCTATGGCAGCCTGAGCTG 0: 1
1: 4
2: 0
3: 14
4: 139
Right 1075062307 10:119265687-119265709 CCTCCATTGGAGTGAGTGCCTGG No data
1075062302_1075062304 -9 Left 1075062302 10:119265641-119265663 CCAGTCTATGGCAGCCTGAGCTG 0: 1
1: 4
2: 0
3: 14
4: 139
Right 1075062304 10:119265655-119265677 CCTGAGCTGATCAGTACAGTCGG No data
1075062302_1075062308 24 Left 1075062302 10:119265641-119265663 CCAGTCTATGGCAGCCTGAGCTG 0: 1
1: 4
2: 0
3: 14
4: 139
Right 1075062308 10:119265688-119265710 CTCCATTGGAGTGAGTGCCTGGG No data
1075062302_1075062305 10 Left 1075062302 10:119265641-119265663 CCAGTCTATGGCAGCCTGAGCTG 0: 1
1: 4
2: 0
3: 14
4: 139
Right 1075062305 10:119265674-119265696 TCGGAGTTCTCAACCTCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075062302 Original CRISPR CAGCTCAGGCTGCCATAGAC TGG (reversed) Intronic
904485933 1:30824591-30824613 CAGCACCGGCTGCCATTGGCCGG + Intergenic
905514578 1:38552848-38552870 CAGCTCAGGCTGCCATAAACTGG + Intergenic
905532709 1:38694754-38694776 TAGTTCGGGCTGCCATACACTGG + Intergenic
906521506 1:46469580-46469602 CAGGGCAGGCTGCCCCAGACTGG - Intergenic
907109112 1:51910294-51910316 CAGCTCAGCCTGGCACACACGGG + Exonic
910344804 1:86224494-86224516 CGGCTCAGGCAGCCATGGTCAGG - Intergenic
910492670 1:87789732-87789754 GAGCTAAGACTGGCATAGACTGG + Intergenic
910507960 1:87971740-87971762 CAGCACAGGCATCCATAGCCAGG + Intergenic
912947421 1:114096577-114096599 CACCTCAGCCTGCCAGAAACAGG + Intronic
916513645 1:165495735-165495757 GAGGTCAGGCAGCCATAAACAGG - Intergenic
918568226 1:185955709-185955731 CAGCTCTGGCAGCCAAAGACAGG - Intronic
919861101 1:201739995-201740017 CGGCTCAGGCGGCCATTCACCGG - Intronic
919885861 1:201934284-201934306 CAGCACTGGCAGCCATAGGCTGG - Intronic
921712660 1:218388268-218388290 CAGGTCAGACTGCCTTGGACAGG - Intronic
922994122 1:229942639-229942661 CCACGCAGGCTGCCAAAGACTGG - Intergenic
1062825763 10:567436-567458 CACCTCAGCCTCCCAAAGACAGG + Intronic
1063267739 10:4473127-4473149 CAGTTTAGGCTGCCATAACCTGG - Intergenic
1068828467 10:61466198-61466220 CAACTCAGGCTGCCATAACAAGG - Intergenic
1071079990 10:81799297-81799319 AGGCTGAGGCTGCCAGAGACTGG + Intergenic
1072310638 10:94150940-94150962 CAGCTCAGACTGCCAGAACCTGG - Intronic
1073107991 10:101043512-101043534 CAGCTCAGGCTGCCAGACAAAGG + Intergenic
1073550799 10:104399346-104399368 CAGCTCAGCCTGACAAAGAGTGG - Exonic
1074765869 10:116699597-116699619 TAGGTCAGGATGCCACAGACGGG - Intronic
1075062302 10:119265641-119265663 CAGCTCAGGCTGCCATAGACTGG - Intronic
1075590185 10:123685459-123685481 CAGCTCAGCCAGCCACAGCCGGG + Intronic
1075663394 10:124213941-124213963 CAGCCCAGGTTGAAATAGACAGG - Intergenic
1076737748 10:132466284-132466306 CAGCCCAGCCTGCCCCAGACAGG + Intergenic
1077531554 11:3098842-3098864 CAGCCCAGGCTGGCATGCACTGG + Intronic
1079134019 11:17765952-17765974 CTGCTCAGGCTGCCATCTCCCGG - Intronic
1080310528 11:30886399-30886421 CTGCTCAGGCTGCCACAAACTGG + Intronic
1082008450 11:47434460-47434482 CAGCTCAGGCTGCCATAACAAGG - Intergenic
1085076130 11:73594346-73594368 CAGCTCAGCCTCCCAAAGTCTGG + Intronic
1087012114 11:93524246-93524268 CAGCTCAGGCTCACAAAGCCAGG + Intronic
1087774235 11:102243083-102243105 CTGCTCAGGCTGCCCTGGGCAGG - Intergenic
1088255157 11:107896630-107896652 CACCTCAGGCTTCCAAAGTCTGG - Intronic
1089739408 11:120571950-120571972 CAGCTCCAGCTGACATAGACAGG - Intronic
1090855957 11:130609529-130609551 TAGCACAGGCTGCCTTGGACAGG - Intergenic
1091676086 12:2491198-2491220 CAGATCAGGTTGCCAGGGACTGG + Intronic
1092933707 12:13340475-13340497 CAGCTCAAGCTGTCAGAGGCAGG + Intergenic
1096747022 12:53735732-53735754 CAGCTGAGGCTGTAATAGATGGG - Intergenic
1106459357 13:29955374-29955396 CAGCTGAGGGTGCCATGGAGGGG - Intergenic
1108364405 13:49695557-49695579 AGGCTGAGGCTGCCATACACTGG - Intergenic
1109201693 13:59438346-59438368 CAACTCAGGCTGCTAAAGATTGG + Intergenic
1111999064 13:95193330-95193352 CAGCTCAGGCTGCTTAAAACAGG - Intronic
1112195250 13:97219413-97219435 CAACTCAGGCTGCCATAGACTGG + Intergenic
1116515592 14:45800969-45800991 GAGGTGAGGCTGCCATAGAAAGG - Intergenic
1117445429 14:55799655-55799677 AAGCTCTGTCTGCCATAGATAGG + Intergenic
1118729285 14:68655280-68655302 CTGCTCAGGCTGCCGTGGCCCGG - Intronic
1118735978 14:68702300-68702322 CAGCCCAGGCTGCCTCAGGCAGG - Intronic
1120142656 14:80945701-80945723 GAGCTGAGGCCGCCATAGAGAGG + Intronic
1121695772 14:95910722-95910744 CAGCACAGGCAGCCACAGAATGG - Intergenic
1122532449 14:102438052-102438074 AAGCTGAGGATGCCATAGCCGGG - Exonic
1123017676 14:105383139-105383161 CAGCCCAGGCTTCCAAGGACAGG - Intronic
1124211508 15:27768744-27768766 CACCACAGGGTCCCATAGACAGG - Intronic
1128658271 15:69478491-69478513 GAGCTCAGCCTGAAATAGACAGG + Intergenic
1130651395 15:85764020-85764042 CAACTCAGGCAGCCGCAGACCGG - Intronic
1133119216 16:3596072-3596094 CGGCTGAGGCTGCCATGGACTGG - Intronic
1135518179 16:23152533-23152555 CAGCACAGGCAGACAGAGACGGG + Intergenic
1136774188 16:32862867-32862889 CATCTCAGACTCCCAGAGACTGG - Intergenic
1136896423 16:33998647-33998669 CATCTCAGACTCCCAGAGACTGG + Intergenic
1142037533 16:87870912-87870934 CAGCCCAGGCAGCCACAGGCGGG + Intergenic
1142316842 16:89352697-89352719 CAGCTGAGGCTTCAATAAACTGG - Intronic
1203076612 16_KI270728v1_random:1124986-1125008 CATCTCAGACTCCCAGAGACTGG - Intergenic
1143088798 17:4436260-4436282 CAGCTCAGCATGCCAGAGAGTGG + Intronic
1143158618 17:4854360-4854382 CAGATCTGGCTGCCTCAGACAGG - Intronic
1144026850 17:11284998-11285020 CAGCTCAGGATGCTAAACACGGG + Intronic
1145238925 17:21228261-21228283 CAACCCAGGCTGCTGTAGACAGG - Intergenic
1145878146 17:28335368-28335390 CAGCCCAGGCTGATGTAGACAGG + Exonic
1145932908 17:28698740-28698762 CAGCTCAGGCTGCATTAGTAGGG + Intronic
1146802587 17:35838524-35838546 CAGCTAAGGCAGCCATTGACTGG + Exonic
1151578661 17:74965203-74965225 CAGCTCAGGCTGCCCTTGCCAGG + Intronic
1152699165 17:81810727-81810749 GAGCTCAGGCTTCCAGAGAGAGG + Intronic
1153321575 18:3778954-3778976 GAGCTCAGGTTGGGATAGACTGG - Intronic
1155166474 18:23236245-23236267 AAGCTCAGGCTGTCAACGACTGG - Intronic
1157500233 18:48185291-48185313 CAGCTCTGGCTGGCATGGCCCGG - Intronic
1160137125 18:76281944-76281966 CCACTCAGACTGCCAAAGACTGG + Intergenic
1162774902 19:12973559-12973581 CAGCTCAGCCTCCCGTCGACGGG + Exonic
1163360098 19:16840502-16840524 CAGCTCAGGCTGCCACAACGAGG - Intronic
1168246847 19:55116895-55116917 CAGCACAGGCTGCCAAAGCCAGG + Intronic
926441661 2:12895455-12895477 CAGCTCAGGCTGGCAAATACAGG + Intergenic
928172620 2:29013046-29013068 CAGCTGAGGCTGCCTGAGGCTGG - Intronic
932134738 2:69218448-69218470 CAACTCAGTGTGCCATAGCCAGG + Intronic
935654706 2:105412175-105412197 CAGCCCAGGCTTCCATAGATAGG + Intronic
936966298 2:118130470-118130492 CAGCCAAGGCTGGCCTAGACTGG + Intergenic
940504144 2:154531285-154531307 CAACTCACTCTGCCATAGAGAGG + Intergenic
948263252 2:236619971-236619993 AAGCTGATACTGCCATAGACAGG + Intergenic
1169051154 20:2578973-2578995 GAGCCCAGGCTGCCAGAGGCAGG - Intronic
1171486643 20:25490679-25490701 CAGCTCAGACAGCCATTGCCAGG + Intronic
1172121780 20:32603010-32603032 CGGCTCAGGCTGGCATGGGCTGG + Intronic
1172980230 20:38936061-38936083 CAGCACAGGCTGACATTGAGTGG + Intronic
1175981550 20:62741234-62741256 CAGCTCAGCCGGGCACAGACAGG + Intronic
1176044846 20:63087219-63087241 GAGCTCTGGATGCCACAGACAGG - Intergenic
1177407364 21:20687220-20687242 TAGCTCAGACTGCCATAAACTGG - Intergenic
1179040195 21:37796023-37796045 CCCCTCAGGCTCCCATAGAACGG - Intronic
1179721807 21:43320585-43320607 CATCTCAGGCTGCCAGAAGCTGG + Intergenic
1183106814 22:35620801-35620823 CAACTCAGGAGGCCAGAGACGGG - Intronic
950688468 3:14636319-14636341 CAGCTCAAACTATCATAGACTGG - Intergenic
950868503 3:16208993-16209015 CATCTCAGGTTGCCACACACTGG - Intronic
952255501 3:31691689-31691711 CAACTCAGGCTGGCATACAGTGG - Intronic
952454097 3:33456840-33456862 CAGCTCAGGCTCCCTTAGCTGGG + Intergenic
954122356 3:48506865-48506887 CAGCTCAGGCTTGCAAAGCCTGG + Intergenic
961450087 3:126998756-126998778 CAGCCAGGGCTGCCTTAGACAGG - Intronic
961524841 3:127490225-127490247 CTGCTCAGGCTGCCATAGACTGG - Intergenic
961819041 3:129565867-129565889 CAGGTCAGGCTGTGACAGACTGG - Exonic
967378134 3:188828287-188828309 CAGCTCAGGCTGCCTAACTCTGG - Intronic
968794883 4:2696742-2696764 CAGTTCAGGCCACCAGAGACAGG - Intronic
969279840 4:6162337-6162359 CAGCTAAGGCAGCCAGAGCCTGG + Intronic
972080320 4:35141555-35141577 CAAGTCAGGCTGCCAGATACGGG + Intergenic
974208465 4:58738577-58738599 CAGGTCAGGCTGCAATAGCATGG - Intergenic
974700753 4:65442469-65442491 CAGCTAGCGATGCCATAGACTGG - Intronic
979252726 4:118582221-118582243 CAACTCAGGCTGCCATAGACTGG + Intergenic
982878143 4:160673080-160673102 GAGCTGAAGCTGCCATAGAGAGG + Intergenic
985793466 5:1945377-1945399 CAGCTGCGGCTGCCATCCACAGG - Intergenic
986768425 5:10949436-10949458 CTGGTCAGCCTGCTATAGACTGG + Intergenic
988942875 5:36163693-36163715 CAGCTCAGGGAGGCACAGACAGG - Exonic
993530242 5:89015653-89015675 CAGCCCAGGCTTTCATAGAGAGG - Intergenic
993891317 5:93477983-93478005 CTCCTCAAGCTGGCATAGACTGG + Intergenic
993921346 5:93807987-93808009 CACATCAGGCTGCCTTGGACAGG + Intronic
997734886 5:136206001-136206023 CAGCACAGGCCGCCAAACACAGG - Intergenic
999743559 5:154574899-154574921 CTGTTCAGGATGGCATAGACTGG - Intergenic
1000469128 5:161617910-161617932 CACCTCAGTCTCCCAAAGACTGG - Intronic
1000497253 5:162000187-162000209 CATCTCAGGCTGACATTAACAGG - Intergenic
1002184955 5:177450034-177450056 CAGCTCAGGTCTCCATAGCCAGG - Intronic
1003160335 6:3628947-3628969 CAGCCCAGGCTGCCATTTAATGG - Intergenic
1005166112 6:22923184-22923206 CAGCTCAGGCCTCCACAGATGGG + Intergenic
1006183841 6:32169363-32169385 CAGCTCTGGCTGACAGAGTCCGG - Exonic
1010314862 6:74436247-74436269 CAGCTCAGGCTGCTATAACAAGG + Intergenic
1010385314 6:75273160-75273182 CAGCTCTGGCTAGCTTAGACAGG - Intronic
1011239499 6:85255936-85255958 TAGCTCAGGCTGACATAGGCTGG - Intergenic
1011698766 6:89936227-89936249 CAGATCAGGCTTCCACAGGCAGG + Intronic
1019397846 7:832424-832446 CAGCTCAGGTTGACTGAGACAGG + Intronic
1019628393 7:2033047-2033069 CAGCTGACGCTGCCACTGACTGG + Intronic
1027352654 7:77327474-77327496 CAGCTTAGGCTGACAGAGCCTGG - Intronic
1036662411 8:10716626-10716648 CAGCCCGGGCTGGCATAGATGGG - Intergenic
1039384360 8:37119288-37119310 CAGCTCAGAATACCATAGATTGG - Intergenic
1041311494 8:56522173-56522195 CAGCTCAGGGTGACAAATACTGG + Intergenic
1048465370 8:134661104-134661126 CTGGACAGGCTGCCATGGACAGG + Intronic
1049444570 8:142624108-142624130 CAGCCCAAGCTGCCAAAGGCCGG - Intergenic
1049694675 8:143977392-143977414 CAGCTCAGGCGGCCACAGTTGGG + Exonic
1053564111 9:39229787-39229809 CAGCACAGGCTCCCATAAAAAGG + Intronic
1053564218 9:39231193-39231215 CAGCACAGGCTCCCATAAAAAGG + Intronic
1053830005 9:42069064-42069086 CAGCACAGGCTCCCATAAAAAGG + Intronic
1054132930 9:61387841-61387863 CAGCACAGGCTCCCATAAAAAGG - Intergenic
1054133037 9:61389247-61389269 CAGCACAGGCTCCCATAAAAAGG - Intergenic
1054600551 9:67118389-67118411 CAGCACAGGCTCCCATAAAAAGG - Intergenic
1057562359 9:96138532-96138554 TAGCTCAGGCTGCCATAACAGGG - Intergenic
1058755936 9:108083280-108083302 CAGGTCACACTGCCAGAGACAGG - Intergenic
1061166916 9:128928282-128928304 CAGCTCCTGCAGCCAGAGACAGG + Intronic
1062032467 9:134367826-134367848 CAGTTTCGGCTGCCAGAGACAGG - Intronic
1062443973 9:136585691-136585713 CAGCTCTGGAGGCCATAGAGAGG + Intergenic
1189198789 X:39174296-39174318 CAGCTAGGGCTGCCACAGCCAGG + Intergenic
1191839172 X:65498364-65498386 CAGCTCAGACAGCCATTCACGGG - Intronic
1192546518 X:72018801-72018823 CTGCTCTGGCTGCCAAAGGCCGG + Intergenic
1193517540 X:82487468-82487490 CAGCGGTGGCTGCCAGAGACTGG + Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1197505079 X:127291719-127291741 CAGCTGAGGCTGCCATAACAAGG - Intergenic
1199097504 X:143759610-143759632 CAGCTCAGGCCCCTATGGACAGG + Intergenic
1200105771 X:153711205-153711227 CATCTCAGACTCCCAGAGACTGG + Intronic