ID: 1075072238

View in Genome Browser
Species Human (GRCh38)
Location 10:119327037-119327059
Sequence CTGTGGGTCCTGCCCTCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075072228_1075072238 -5 Left 1075072228 10:119327019-119327041 CCCCTTTCTTCCTGGAGCCTGTG 0: 1
1: 1
2: 4
3: 58
4: 466
Right 1075072238 10:119327037-119327059 CTGTGGGTCCTGCCCTCAGGGGG No data
1075072231_1075072238 -7 Left 1075072231 10:119327021-119327043 CCTTTCTTCCTGGAGCCTGTGGG 0: 1
1: 0
2: 3
3: 32
4: 357
Right 1075072238 10:119327037-119327059 CTGTGGGTCCTGCCCTCAGGGGG No data
1075072226_1075072238 10 Left 1075072226 10:119327004-119327026 CCGCTCATAACTTCTCCCCTTTC 0: 1
1: 0
2: 3
3: 29
4: 388
Right 1075072238 10:119327037-119327059 CTGTGGGTCCTGCCCTCAGGGGG No data
1075072229_1075072238 -6 Left 1075072229 10:119327020-119327042 CCCTTTCTTCCTGGAGCCTGTGG 0: 1
1: 0
2: 2
3: 43
4: 410
Right 1075072238 10:119327037-119327059 CTGTGGGTCCTGCCCTCAGGGGG No data
1075072222_1075072238 30 Left 1075072222 10:119326984-119327006 CCAGGCCCAACACAGAGCCACCG 0: 1
1: 0
2: 1
3: 21
4: 216
Right 1075072238 10:119327037-119327059 CTGTGGGTCCTGCCCTCAGGGGG No data
1075072224_1075072238 24 Left 1075072224 10:119326990-119327012 CCAACACAGAGCCACCGCTCATA 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1075072238 10:119327037-119327059 CTGTGGGTCCTGCCCTCAGGGGG No data
1075072223_1075072238 25 Left 1075072223 10:119326989-119327011 CCCAACACAGAGCCACCGCTCAT No data
Right 1075072238 10:119327037-119327059 CTGTGGGTCCTGCCCTCAGGGGG No data
1075072225_1075072238 13 Left 1075072225 10:119327001-119327023 CCACCGCTCATAACTTCTCCCCT 0: 1
1: 0
2: 2
3: 11
4: 168
Right 1075072238 10:119327037-119327059 CTGTGGGTCCTGCCCTCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075072238 Original CRISPR CTGTGGGTCCTGCCCTCAGG GGG Intronic
No off target data available for this crispr