ID: 1075073702

View in Genome Browser
Species Human (GRCh38)
Location 10:119336264-119336286
Sequence CACAGTTTGCCCAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075073694_1075073702 -5 Left 1075073694 10:119336246-119336268 CCTTCCTCCCCACGGCTCCACAG 0: 1
1: 0
2: 3
3: 54
4: 467
Right 1075073702 10:119336264-119336286 CACAGTTTGCCCAGGGAAGCTGG No data
1075073688_1075073702 21 Left 1075073688 10:119336220-119336242 CCCTGATTCCTGCAGTCCTCAGC 0: 1
1: 0
2: 3
3: 23
4: 310
Right 1075073702 10:119336264-119336286 CACAGTTTGCCCAGGGAAGCTGG No data
1075073689_1075073702 20 Left 1075073689 10:119336221-119336243 CCTGATTCCTGCAGTCCTCAGCC 0: 1
1: 0
2: 2
3: 52
4: 408
Right 1075073702 10:119336264-119336286 CACAGTTTGCCCAGGGAAGCTGG No data
1075073690_1075073702 13 Left 1075073690 10:119336228-119336250 CCTGCAGTCCTCAGCCTTCCTTC 0: 1
1: 0
2: 7
3: 54
4: 497
Right 1075073702 10:119336264-119336286 CACAGTTTGCCCAGGGAAGCTGG No data
1075073695_1075073702 -9 Left 1075073695 10:119336250-119336272 CCTCCCCACGGCTCCACAGTTTG 0: 1
1: 0
2: 1
3: 9
4: 127
Right 1075073702 10:119336264-119336286 CACAGTTTGCCCAGGGAAGCTGG No data
1075073687_1075073702 25 Left 1075073687 10:119336216-119336238 CCTGCCCTGATTCCTGCAGTCCT 0: 1
1: 1
2: 4
3: 41
4: 351
Right 1075073702 10:119336264-119336286 CACAGTTTGCCCAGGGAAGCTGG No data
1075073693_1075073702 -1 Left 1075073693 10:119336242-119336264 CCTTCCTTCCTCCCCACGGCTCC 0: 1
1: 0
2: 7
3: 119
4: 1172
Right 1075073702 10:119336264-119336286 CACAGTTTGCCCAGGGAAGCTGG No data
1075073691_1075073702 5 Left 1075073691 10:119336236-119336258 CCTCAGCCTTCCTTCCTCCCCAC 0: 1
1: 2
2: 18
3: 178
4: 1540
Right 1075073702 10:119336264-119336286 CACAGTTTGCCCAGGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075073702 Original CRISPR CACAGTTTGCCCAGGGAAGC TGG Intronic
No off target data available for this crispr