ID: 1075075876

View in Genome Browser
Species Human (GRCh38)
Location 10:119349787-119349809
Sequence TTGAGGAAGGAAGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075075868_1075075876 11 Left 1075075868 10:119349753-119349775 CCAGGACTGATTCAGTGGCCACC 0: 1
1: 0
2: 3
3: 20
4: 140
Right 1075075876 10:119349787-119349809 TTGAGGAAGGAAGAGGAGGAAGG No data
1075075867_1075075876 15 Left 1075075867 10:119349749-119349771 CCATCCAGGACTGATTCAGTGGC 0: 1
1: 0
2: 0
3: 18
4: 145
Right 1075075876 10:119349787-119349809 TTGAGGAAGGAAGAGGAGGAAGG No data
1075075865_1075075876 16 Left 1075075865 10:119349748-119349770 CCCATCCAGGACTGATTCAGTGG 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1075075876 10:119349787-119349809 TTGAGGAAGGAAGAGGAGGAAGG No data
1075075864_1075075876 24 Left 1075075864 10:119349740-119349762 CCGGATCTCCCATCCAGGACTGA No data
Right 1075075876 10:119349787-119349809 TTGAGGAAGGAAGAGGAGGAAGG No data
1075075870_1075075876 -7 Left 1075075870 10:119349771-119349793 CCACCACTTCCTACGCTTGAGGA 0: 1
1: 0
2: 0
3: 6
4: 226
Right 1075075876 10:119349787-119349809 TTGAGGAAGGAAGAGGAGGAAGG No data
1075075871_1075075876 -10 Left 1075075871 10:119349774-119349796 CCACTTCCTACGCTTGAGGAAGG 0: 1
1: 0
2: 2
3: 8
4: 137
Right 1075075876 10:119349787-119349809 TTGAGGAAGGAAGAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075075876 Original CRISPR TTGAGGAAGGAAGAGGAGGA AGG Intronic
No off target data available for this crispr