ID: 1075076303

View in Genome Browser
Species Human (GRCh38)
Location 10:119352935-119352957
Sequence CAGGGGAGAGAGAGGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7253
Summary {0: 1, 1: 1, 2: 96, 3: 891, 4: 6264}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075076303_1075076317 24 Left 1075076303 10:119352935-119352957 CCGTCCTCCCTCTCTCTCCCCTG 0: 1
1: 1
2: 96
3: 891
4: 6264
Right 1075076317 10:119352982-119353004 CTTATCTCAGGAGGGTATGCTGG No data
1075076303_1075076314 12 Left 1075076303 10:119352935-119352957 CCGTCCTCCCTCTCTCTCCCCTG 0: 1
1: 1
2: 96
3: 891
4: 6264
Right 1075076314 10:119352970-119352992 TGCTTTTCACTTCTTATCTCAGG No data
1075076303_1075076316 16 Left 1075076303 10:119352935-119352957 CCGTCCTCCCTCTCTCTCCCCTG 0: 1
1: 1
2: 96
3: 891
4: 6264
Right 1075076316 10:119352974-119352996 TTTCACTTCTTATCTCAGGAGGG No data
1075076303_1075076315 15 Left 1075076303 10:119352935-119352957 CCGTCCTCCCTCTCTCTCCCCTG 0: 1
1: 1
2: 96
3: 891
4: 6264
Right 1075076315 10:119352973-119352995 TTTTCACTTCTTATCTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075076303 Original CRISPR CAGGGGAGAGAGAGGGAGGA CGG (reversed) Intronic
Too many off-targets to display for this crispr