ID: 1075076314

View in Genome Browser
Species Human (GRCh38)
Location 10:119352970-119352992
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075076310_1075076314 -5 Left 1075076310 10:119352952-119352974 CCCCTGAGGACCTGGGTTTGCTT 0: 1
1: 0
2: 2
3: 16
4: 249
Right 1075076314 10:119352970-119352992 TGCTTTTCACTTCTTATCTCAGG No data
1075076305_1075076314 8 Left 1075076305 10:119352939-119352961 CCTCCCTCTCTCTCCCCTGAGGA No data
Right 1075076314 10:119352970-119352992 TGCTTTTCACTTCTTATCTCAGG No data
1075076312_1075076314 -7 Left 1075076312 10:119352954-119352976 CCTGAGGACCTGGGTTTGCTTTT 0: 1
1: 0
2: 0
3: 35
4: 288
Right 1075076314 10:119352970-119352992 TGCTTTTCACTTCTTATCTCAGG No data
1075076303_1075076314 12 Left 1075076303 10:119352935-119352957 CCGTCCTCCCTCTCTCTCCCCTG 0: 1
1: 1
2: 96
3: 891
4: 6264
Right 1075076314 10:119352970-119352992 TGCTTTTCACTTCTTATCTCAGG No data
1075076300_1075076314 23 Left 1075076300 10:119352924-119352946 CCACCCGGGCTCCGTCCTCCCTC 0: 1
1: 0
2: 2
3: 70
4: 691
Right 1075076314 10:119352970-119352992 TGCTTTTCACTTCTTATCTCAGG No data
1075076302_1075076314 19 Left 1075076302 10:119352928-119352950 CCGGGCTCCGTCCTCCCTCTCTC 0: 1
1: 0
2: 8
3: 119
4: 1269
Right 1075076314 10:119352970-119352992 TGCTTTTCACTTCTTATCTCAGG No data
1075076301_1075076314 20 Left 1075076301 10:119352927-119352949 CCCGGGCTCCGTCCTCCCTCTCT No data
Right 1075076314 10:119352970-119352992 TGCTTTTCACTTCTTATCTCAGG No data
1075076307_1075076314 4 Left 1075076307 10:119352943-119352965 CCTCTCTCTCCCCTGAGGACCTG 0: 1
1: 0
2: 8
3: 62
4: 460
Right 1075076314 10:119352970-119352992 TGCTTTTCACTTCTTATCTCAGG No data
1075076306_1075076314 5 Left 1075076306 10:119352942-119352964 CCCTCTCTCTCCCCTGAGGACCT No data
Right 1075076314 10:119352970-119352992 TGCTTTTCACTTCTTATCTCAGG No data
1075076311_1075076314 -6 Left 1075076311 10:119352953-119352975 CCCTGAGGACCTGGGTTTGCTTT 0: 1
1: 0
2: 2
3: 31
4: 263
Right 1075076314 10:119352970-119352992 TGCTTTTCACTTCTTATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr