ID: 1075076317

View in Genome Browser
Species Human (GRCh38)
Location 10:119352982-119353004
Sequence CTTATCTCAGGAGGGTATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075076305_1075076317 20 Left 1075076305 10:119352939-119352961 CCTCCCTCTCTCTCCCCTGAGGA No data
Right 1075076317 10:119352982-119353004 CTTATCTCAGGAGGGTATGCTGG No data
1075076313_1075076317 -3 Left 1075076313 10:119352962-119352984 CCTGGGTTTGCTTTTCACTTCTT 0: 1
1: 0
2: 6
3: 42
4: 624
Right 1075076317 10:119352982-119353004 CTTATCTCAGGAGGGTATGCTGG No data
1075076312_1075076317 5 Left 1075076312 10:119352954-119352976 CCTGAGGACCTGGGTTTGCTTTT 0: 1
1: 0
2: 0
3: 35
4: 288
Right 1075076317 10:119352982-119353004 CTTATCTCAGGAGGGTATGCTGG No data
1075076306_1075076317 17 Left 1075076306 10:119352942-119352964 CCCTCTCTCTCCCCTGAGGACCT No data
Right 1075076317 10:119352982-119353004 CTTATCTCAGGAGGGTATGCTGG No data
1075076307_1075076317 16 Left 1075076307 10:119352943-119352965 CCTCTCTCTCCCCTGAGGACCTG 0: 1
1: 0
2: 8
3: 62
4: 460
Right 1075076317 10:119352982-119353004 CTTATCTCAGGAGGGTATGCTGG No data
1075076311_1075076317 6 Left 1075076311 10:119352953-119352975 CCCTGAGGACCTGGGTTTGCTTT 0: 1
1: 0
2: 2
3: 31
4: 263
Right 1075076317 10:119352982-119353004 CTTATCTCAGGAGGGTATGCTGG No data
1075076303_1075076317 24 Left 1075076303 10:119352935-119352957 CCGTCCTCCCTCTCTCTCCCCTG 0: 1
1: 1
2: 96
3: 891
4: 6264
Right 1075076317 10:119352982-119353004 CTTATCTCAGGAGGGTATGCTGG No data
1075076310_1075076317 7 Left 1075076310 10:119352952-119352974 CCCCTGAGGACCTGGGTTTGCTT 0: 1
1: 0
2: 2
3: 16
4: 249
Right 1075076317 10:119352982-119353004 CTTATCTCAGGAGGGTATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075076317 Original CRISPR CTTATCTCAGGAGGGTATGC TGG Intronic
No off target data available for this crispr