ID: 1075076939

View in Genome Browser
Species Human (GRCh38)
Location 10:119358091-119358113
Sequence GCACAATGGGGAAACCAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075076939_1075076951 -3 Left 1075076939 10:119358091-119358113 CCCGGCTGGTTTCCCCATTGTGC No data
Right 1075076951 10:119358111-119358133 TGCAGTGGGGAGGGAGAAAGGGG No data
1075076939_1075076950 -4 Left 1075076939 10:119358091-119358113 CCCGGCTGGTTTCCCCATTGTGC No data
Right 1075076950 10:119358110-119358132 GTGCAGTGGGGAGGGAGAAAGGG No data
1075076939_1075076952 18 Left 1075076939 10:119358091-119358113 CCCGGCTGGTTTCCCCATTGTGC No data
Right 1075076952 10:119358132-119358154 GGCCAGCTTGCCTGAGTTCCTGG No data
1075076939_1075076949 -5 Left 1075076939 10:119358091-119358113 CCCGGCTGGTTTCCCCATTGTGC No data
Right 1075076949 10:119358109-119358131 TGTGCAGTGGGGAGGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075076939 Original CRISPR GCACAATGGGGAAACCAGCC GGG (reversed) Intronic