ID: 1075076946

View in Genome Browser
Species Human (GRCh38)
Location 10:119358103-119358125
Sequence TCCCTCCCCACTGCACAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075076946_1075076952 6 Left 1075076946 10:119358103-119358125 CCCCATTGTGCAGTGGGGAGGGA No data
Right 1075076952 10:119358132-119358154 GGCCAGCTTGCCTGAGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075076946 Original CRISPR TCCCTCCCCACTGCACAATG GGG (reversed) Intronic