ID: 1075076947

View in Genome Browser
Species Human (GRCh38)
Location 10:119358104-119358126
Sequence CTCCCTCCCCACTGCACAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075076947_1075076952 5 Left 1075076947 10:119358104-119358126 CCCATTGTGCAGTGGGGAGGGAG No data
Right 1075076952 10:119358132-119358154 GGCCAGCTTGCCTGAGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075076947 Original CRISPR CTCCCTCCCCACTGCACAAT GGG (reversed) Intronic