ID: 1075076952

View in Genome Browser
Species Human (GRCh38)
Location 10:119358132-119358154
Sequence GGCCAGCTTGCCTGAGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075076938_1075076952 19 Left 1075076938 10:119358090-119358112 CCCCGGCTGGTTTCCCCATTGTG 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1075076952 10:119358132-119358154 GGCCAGCTTGCCTGAGTTCCTGG No data
1075076946_1075076952 6 Left 1075076946 10:119358103-119358125 CCCCATTGTGCAGTGGGGAGGGA 0: 1
1: 0
2: 2
3: 24
4: 207
Right 1075076952 10:119358132-119358154 GGCCAGCTTGCCTGAGTTCCTGG No data
1075076947_1075076952 5 Left 1075076947 10:119358104-119358126 CCCATTGTGCAGTGGGGAGGGAG 0: 1
1: 0
2: 1
3: 24
4: 261
Right 1075076952 10:119358132-119358154 GGCCAGCTTGCCTGAGTTCCTGG No data
1075076940_1075076952 17 Left 1075076940 10:119358092-119358114 CCGGCTGGTTTCCCCATTGTGCA 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1075076952 10:119358132-119358154 GGCCAGCTTGCCTGAGTTCCTGG No data
1075076939_1075076952 18 Left 1075076939 10:119358091-119358113 CCCGGCTGGTTTCCCCATTGTGC 0: 1
1: 0
2: 0
3: 14
4: 176
Right 1075076952 10:119358132-119358154 GGCCAGCTTGCCTGAGTTCCTGG No data
1075076948_1075076952 4 Left 1075076948 10:119358105-119358127 CCATTGTGCAGTGGGGAGGGAGA 0: 1
1: 0
2: 5
3: 34
4: 292
Right 1075076952 10:119358132-119358154 GGCCAGCTTGCCTGAGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075076952 Original CRISPR GGCCAGCTTGCCTGAGTTCC TGG Intronic
No off target data available for this crispr