ID: 1075079482

View in Genome Browser
Species Human (GRCh38)
Location 10:119373545-119373567
Sequence GACTCACAGTTCCACGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22098
Summary {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075079482_1075079485 14 Left 1075079482 10:119373545-119373567 CCAGTCACGTGGAACTGTGAGTC 0: 36
1: 862
2: 5111
3: 8006
4: 8083
Right 1075079485 10:119373582-119373604 CCTTTATAAATTACCCAGTCAGG 0: 53
1: 159
2: 193
3: 226
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075079482 Original CRISPR GACTCACAGTTCCACGTGAC TGG (reversed) Intronic
Too many off-targets to display for this crispr