ID: 1075079885

View in Genome Browser
Species Human (GRCh38)
Location 10:119376232-119376254
Sequence ATTTGGAAGAGGAAGGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 398}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075079885_1075079889 11 Left 1075079885 10:119376232-119376254 CCAGTCACCTTCCTCTTCCAAAT 0: 1
1: 0
2: 1
3: 46
4: 398
Right 1075079889 10:119376266-119376288 GAGATGATGTCCTCCATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075079885 Original CRISPR ATTTGGAAGAGGAAGGTGAC TGG (reversed) Intronic
900457611 1:2785132-2785154 CTTTGGGAGAGGAGGGTGAGGGG + Intronic
900479218 1:2890028-2890050 AGGTGGTAGAGGAAGGTGAAGGG + Intergenic
900760315 1:4466117-4466139 ATTGGGAAGTGAAAGGTGAAGGG + Intergenic
902343189 1:15797958-15797980 AGTAGGAAGAGGATGGTGAGGGG + Intergenic
902894505 1:19469627-19469649 ATTTGTCAGAGCAAAGTGACCGG + Intronic
905405078 1:37727090-37727112 ATTTGGAGGAGGTAGGTGGCTGG - Exonic
905544980 1:38790476-38790498 ATTTGGTAGAGGCAGGGGAGAGG + Intergenic
905804290 1:40864509-40864531 ATTTGGGAGATGAAAGTGAGAGG + Intergenic
905890502 1:41515925-41515947 ATTTTGCAGATGAAGGTCACAGG + Intronic
909242202 1:73228413-73228435 ATTTGTAAGAAGCAGGTGACAGG + Intergenic
910012287 1:82480300-82480322 ATTGGGAAGAGAAAGGGGAAAGG - Intergenic
910405988 1:86890747-86890769 CTTTGGAAGACGAAGGCGAGAGG - Intronic
910779911 1:90919542-90919564 CTTTTGAATAGGCAGGTGACAGG - Intronic
912254380 1:108044285-108044307 ATTAGGAAGGGGAAGCTGAGTGG - Intergenic
912297509 1:108484609-108484631 TTTTGGAAGTGGAAGGGGGCCGG - Intergenic
912513431 1:110203341-110203363 GTTTGGCAGAGGGAGGGGACCGG + Intergenic
914393787 1:147245261-147245283 ATTTGGAAGGGGAAAGTGAGGGG + Intronic
915737036 1:158091542-158091564 AGCTGGAAGAGCGAGGTGACTGG + Exonic
915776450 1:158493029-158493051 ATTAGGAAGAGGAAGATACCCGG + Intergenic
916551850 1:165857504-165857526 AGTTGGAGGAGGCAGATGACAGG + Intronic
918144748 1:181745647-181745669 ATGTGGATTAGGAAGGTGGCTGG - Intronic
919700776 1:200628980-200629002 GTGGGGAAGAGGAAGGTGACTGG + Intronic
920378629 1:205522940-205522962 ACTGGGAGGAAGAAGGTGACTGG + Intronic
920676792 1:208043714-208043736 GTTTGGCAGAGGAAGGAGCCAGG - Intronic
920828562 1:209445405-209445427 ACTTGGAAGATGAAGGTCAGTGG + Intergenic
921113982 1:212069276-212069298 ATTTGGAAGAGGGAGGGGAGAGG - Intronic
921283740 1:213590926-213590948 ACTTGGAAGAGGAAAGTTAGTGG + Intergenic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
921614430 1:217249802-217249824 ATTTGTAAGTGGAAGATGAGTGG + Intergenic
923430281 1:233913334-233913356 ACCTGGATGAGGAAGGTGACAGG - Intronic
923523959 1:234758332-234758354 ATTGGGAAGAGGAATGTGCCTGG + Intergenic
923784561 1:237054845-237054867 AGATGAAAGAGGAAGGTGAGTGG + Intronic
923990554 1:239432169-239432191 ATAAGGAAGAGGAAGAAGACAGG + Intronic
924092209 1:240513278-240513300 TCTTAGAAGAGAAAGGTGACCGG + Intronic
924817319 1:247454050-247454072 ATGAGGGAGAGGAAGGTCACAGG + Intergenic
1063177911 10:3568807-3568829 ATTTGTAAGAGGAAGAAGAAGGG - Intergenic
1063182297 10:3615143-3615165 AATTGGAAGAATAAGGTGCCTGG - Intergenic
1063454070 10:6170884-6170906 CTCAGGAAGAGGAAGATGACAGG + Intronic
1063457586 10:6195193-6195215 CTTTGGAAGAAGATGGTGTCAGG + Intronic
1063640424 10:7824416-7824438 ATTTGGTGTGGGAAGGTGACAGG - Exonic
1064329446 10:14379921-14379943 ATTTTGAAGAGGAAACTGTCAGG - Intronic
1064774389 10:18759604-18759626 ATTTTGAAGAAAAAGCTGACAGG - Intergenic
1065895417 10:30159104-30159126 ATTTGGTAGATAAAGTTGACAGG - Intergenic
1067913752 10:50374472-50374494 ATTTGGAAGATAAAGCTGATAGG - Intronic
1068488396 10:57689793-57689815 ATTTGGAAGAGGAGTGTACCAGG - Intergenic
1069283245 10:66681721-66681743 ATTTGGAAGAGGAACCTCAGGGG + Intronic
1069403179 10:68071056-68071078 CTGTGGAAGAGAAAAGTGACAGG - Intronic
1069887945 10:71635666-71635688 ATTGGAAAGAGGAAGGTGAGAGG + Intronic
1070511866 10:77169117-77169139 TTTTGGAAGAGGCAAGTAACAGG + Intronic
1070741313 10:78904990-78905012 TTCTGGGAGAGGAAGGGGACAGG - Intergenic
1070983092 10:80665965-80665987 ATATGGAAGAGGAAGGAGTGAGG - Intergenic
1071292991 10:84200893-84200915 CGTTGGAAGAGGGAGGGGACAGG - Intronic
1071481367 10:86067569-86067591 ATAGGCAAGGGGAAGGTGACAGG + Intronic
1072208707 10:93226624-93226646 ATGTGGAAGAGGAAGGGTCCTGG + Intergenic
1072274861 10:93813101-93813123 ATTTGGAAGAAAAAGGAGACTGG - Intergenic
1073151908 10:101317394-101317416 ATTTTGAGGAGGAAAGAGACTGG + Intergenic
1073549006 10:104380165-104380187 ATCTGGAAAAGGAGCGTGACCGG + Exonic
1073584588 10:104697439-104697461 ATTTGGACGAGGAAAGGGTCTGG + Intronic
1073824405 10:107304013-107304035 ATTTTGAAAAGGAAAGTCACAGG + Intergenic
1074078738 10:110151579-110151601 AAGTGGAAGAGGAAGGAGACAGG - Intergenic
1074944511 10:118268341-118268363 ACATGCAAGAGGAAGCTGACGGG - Intergenic
1075079885 10:119376232-119376254 ATTTGGAAGAGGAAGGTGACTGG - Intronic
1076634833 10:131875394-131875416 CCTTGGAAGAGGCAGGTGTCAGG + Intergenic
1077922556 11:6652591-6652613 CTGTGGAAGAGGAAGGGGATGGG + Intronic
1078350353 11:10587767-10587789 TTTTGAAAGAGCATGGTGACCGG - Intronic
1078768723 11:14326654-14326676 ATTTGGGAGGGGGAGGGGACAGG + Intronic
1080524243 11:33098155-33098177 CATTGGGAGAGGAAGGGGACAGG - Intronic
1081351212 11:42054590-42054612 TTTTGGCAGAGCAAGATGACTGG - Intergenic
1081530305 11:43954003-43954025 ATTGGGATGTGCAAGGTGACGGG + Intergenic
1081964048 11:47158776-47158798 CTTTGGGAGAGCAAGGTGAGGGG - Intronic
1084420654 11:69058936-69058958 ATTAGGATGGGGAAGGAGACAGG + Intronic
1084619712 11:70261343-70261365 ATTTGGCAGAGGCAGGGGCCAGG + Intergenic
1085615784 11:77997328-77997350 CTTTGGAAGACCAAGGTGAGAGG + Intergenic
1086640268 11:89145900-89145922 ATGGGGAAGAGGAAGATAACAGG + Intergenic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1088005858 11:104939121-104939143 ATGGGGCAGAGGAAAGTGACTGG + Intergenic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1088138111 11:106581676-106581698 AATTGGATGTGTAAGGTGACTGG - Intergenic
1088433750 11:109787608-109787630 ATTTGGAATGGGTAGGTCACAGG - Intergenic
1088691721 11:112334236-112334258 CTTTGGAAGAGGAAGGCTATGGG + Intergenic
1089137654 11:116262706-116262728 ATTTAGAAGAGGAAAGAGCCTGG + Intergenic
1089634522 11:119803800-119803822 CTTTGAAGGAGGAAGGTGACAGG - Intergenic
1091697087 12:2634998-2635020 ATTTGGAAGAGGAACGAGAAGGG + Intronic
1092044259 12:5417609-5417631 ATTTGTAAGTGGAAGCTGAGAGG - Intergenic
1092658933 12:10718299-10718321 ATGTGGAGGAGGAAGGTGGGTGG - Intronic
1092936949 12:13372945-13372967 ATTTGGAAAAGCAAGGTGTTTGG + Exonic
1093654879 12:21683264-21683286 ATTGGGAAGAGGAATATGCCTGG - Intronic
1095650678 12:44605059-44605081 TTTTGGTAGAGGATGGTAACTGG + Intronic
1096627040 12:52902281-52902303 ATTGGGTAGGGGAAGGAGACAGG + Intronic
1097025479 12:56052222-56052244 ACTCGGAAGGGTAAGGTGACAGG + Intergenic
1097079650 12:56420805-56420827 ATCGGGAAGAGGATGGTGAGTGG - Exonic
1097585751 12:61514196-61514218 ATTTTGAAGAGCAAGATGAATGG - Intergenic
1097930437 12:65178087-65178109 CTTTGGGAGGCGAAGGTGACAGG - Intronic
1098707790 12:73713322-73713344 AATGGGAAGAGGAAGGTGGTGGG - Intergenic
1099305592 12:80950890-80950912 TTTTTGAGCAGGAAGGTGACAGG + Intronic
1099986112 12:89666762-89666784 AATTGAAAGAGGAACATGACAGG - Intronic
1100040802 12:90314624-90314646 ATTTTGAAGAGGGAGGTTAACGG - Intergenic
1100647612 12:96547805-96547827 AGTAGGAAGAGGAAGAGGACAGG - Intronic
1101741705 12:107505155-107505177 AAAGGGAAGAGGAAGGTGATGGG - Intronic
1102919255 12:116779489-116779511 AATTAGAAGAGGTGGGTGACAGG - Intronic
1104850246 12:131869449-131869471 ACTTGGAAAAGGAAGGTCACCGG - Intergenic
1107829569 13:44362415-44362437 AGGAGGAAGAGGAAGGGGACAGG - Intergenic
1107881780 13:44838803-44838825 ATTTGGTGGAGGAAGGGGAATGG - Intergenic
1108372576 13:49785241-49785263 TTTTTAAACAGGAAGGTGACAGG + Intronic
1109185298 13:59260787-59260809 TTTTGTATCAGGAAGGTGACAGG - Intergenic
1109469525 13:62787556-62787578 ATTTGGAAGACGAAAGAGAGAGG + Intergenic
1110254118 13:73413058-73413080 ATTTGGGAGAGCAAGGTGGGAGG - Intergenic
1110505477 13:76280913-76280935 ATTTGGCAGAGGAAGATGTTGGG - Intergenic
1110690252 13:78424176-78424198 AATTGGAAGGGGAAGGGGAAGGG + Intergenic
1111264723 13:85794391-85794413 ATCTGGAAGAGGAAGAAGAGAGG - Exonic
1112273876 13:97997558-97997580 ATTTGGAAGAAGATGAGGACTGG + Exonic
1112311070 13:98317975-98317997 ATGAGGAAGAGGAAGGAGAGAGG - Intronic
1112500773 13:99941346-99941368 AGCTGGAAGAGGAGGGAGACAGG - Intergenic
1114730246 14:24985540-24985562 AGTGGGAACAGGAAGGTAACAGG - Intronic
1115196234 14:30803011-30803033 CTATGGAAGAGGAAGGTGGGAGG - Intergenic
1115268936 14:31530063-31530085 ATCTGTAACAGGAAGGTGAGGGG - Intronic
1115640230 14:35331041-35331063 ATTTGGAAGGCCAAGGTGAACGG + Intergenic
1115647810 14:35382460-35382482 ATTTGGGAGACCAAGGTGAGAGG + Intergenic
1115879499 14:37899265-37899287 GTTTGCAAGAGGAAGGGGGCTGG + Intronic
1116164748 14:41320759-41320781 ATAAGGAAGAGGAAGGTAAAAGG + Intergenic
1117349305 14:54865677-54865699 GTATGGAAGAGGAAGGAGAACGG + Intronic
1117890654 14:60418368-60418390 CTTTGGGAGAAGAAGGTGAGAGG + Intronic
1118221703 14:63860339-63860361 ATTAGGAGGAGGGAGGTGAATGG + Intronic
1119545186 14:75466845-75466867 ATTTGGAGAAGGAAGGAGATAGG - Intronic
1124458827 15:29870133-29870155 ATTAGAAAGAGGAAAGGGACAGG - Intronic
1124682411 15:31745878-31745900 ATTTGGAAGAGGAACTTAAAAGG + Intronic
1125741804 15:41970401-41970423 ATTTGGATGAGGTAGCTGCCAGG + Intronic
1128156384 15:65394403-65394425 GTTTGGGAAAGGAAGGTGAGTGG - Exonic
1128705119 15:69832593-69832615 AAGTGGAAGAGGAAGGGGAAAGG + Intergenic
1128750099 15:70142704-70142726 ATTTGGAGGAGCTTGGTGACAGG - Intergenic
1128957384 15:71962855-71962877 ATTTTGAAAATGAAGGTCACTGG - Intronic
1128992308 15:72271460-72271482 AGTTGGAAAAGGAAGGTGGTGGG + Intronic
1131310781 15:91288019-91288041 AGTTGGGAGGGGAAGGTGGCTGG - Intronic
1134228959 16:12414556-12414578 ACTTGGAAAAGGAAAGAGACCGG - Intronic
1134394566 16:13851361-13851383 ATTTGTAAGAGGAAAGCGATGGG + Intergenic
1134411302 16:14004736-14004758 ATTTGGAAGAGGAAGCTTCAGGG + Intergenic
1135539628 16:23320185-23320207 ACTTGGAAGAGTAAGGTGGCGGG + Intronic
1136945875 16:34650379-34650401 ATTTGGAAGACCAAGGTGGAAGG - Intergenic
1137894769 16:52199502-52199524 ATTTGGAGGAGGAAGGTTTGGGG - Intergenic
1138958701 16:62003714-62003736 ATTTTGAAGATCAAGGTGAGAGG - Intronic
1139022546 16:62768345-62768367 ATGTGGCAGAGGAAGATGATAGG + Intergenic
1140112546 16:72016312-72016334 AAGAGGAAGAGGAAGGGGACTGG + Intronic
1140238298 16:73178729-73178751 ATTTGGAAGGTTAAGGTGAGAGG - Intergenic
1141292456 16:82732530-82732552 ATTTGAAACAGGAAGATGAATGG + Intronic
1141862948 16:86730400-86730422 CTTTGGAAGCGTCAGGTGACAGG - Intergenic
1143767422 17:9146740-9146762 ATTTGGAGGAGGAAAGTGAGGGG + Intronic
1144327204 17:14193728-14193750 CTAAGGAAGAGGAACGTGACCGG - Intronic
1144476092 17:15590591-15590613 CTAAGGAAGAGGAACGTGACCGG - Intronic
1146336949 17:31980921-31980943 CTTTGGAAGACCAAGGTGAGAGG + Intronic
1146594653 17:34157807-34157829 ATTTGAAAGAGAAAGGCAACTGG + Intronic
1146618064 17:34372442-34372464 ATTTGCAACAGGCAGTTGACTGG - Intergenic
1146712320 17:35053118-35053140 TAGTGGAAGAGGAAGGGGACAGG + Intronic
1147002158 17:37371416-37371438 ATTGGGAGGAGGAAAGAGACCGG + Intronic
1149211672 17:54310095-54310117 ATTGGAGAGTGGAAGGTGACAGG + Intergenic
1149242908 17:54671445-54671467 ATTAGGAAGATGAAGCTTACTGG + Intergenic
1150644636 17:66970280-66970302 ATTTGGAAGGGGCAGGTAAGGGG + Intronic
1151477689 17:74353169-74353191 AGTTGGCAGAGGAAGATGAGTGG - Intronic
1152368919 17:79873019-79873041 ATTAGGAAGAGGAAGGAGGTCGG - Intergenic
1153713124 18:7819885-7819907 ATTTTGAAGGGGAAGGGGCCTGG + Intronic
1153911570 18:9709603-9709625 TTTTGGAAGAGGCCGGTGATGGG - Intronic
1156243826 18:35278375-35278397 ATTTTGAAGAGGACAGAGACAGG - Intronic
1156461553 18:37324098-37324120 ACTTGGGGGAGGAAGGTGCCAGG - Intronic
1157035112 18:43962258-43962280 ATGTGGAAGAGGAAAGGGAAGGG - Intergenic
1157087049 18:44591625-44591647 ATTTGGAAGGAGACGGTGATTGG - Intergenic
1157522602 18:48355743-48355765 ATTGAGAAGAGGAAGGTTGCAGG - Intronic
1157736404 18:50053639-50053661 ACTAGGAAGAGGAATGTGAGGGG + Intronic
1157899091 18:51496649-51496671 GTTTGGAAAAGGTAGGTAACTGG + Intergenic
1158872741 18:61704303-61704325 ATTTGGTAAATTAAGGTGACAGG + Intergenic
1159520252 18:69511053-69511075 ATTTTGAAGAGAGAGGTGATTGG + Intronic
1160323664 18:77919837-77919859 ATTTGTGAGAGGCAGGAGACGGG + Intergenic
1160425495 18:78776237-78776259 ATGTGGAGGAGGAAGGAGACTGG + Intergenic
1160583254 18:79899613-79899635 GTGTGGAAGATGGAGGTGACCGG - Exonic
1160950089 19:1662305-1662327 ATTTGGAAGGTGAGGCTGACAGG + Intergenic
1162180036 19:8862396-8862418 CTTGGGAAGAGGAGGGTCACAGG - Intronic
1162554712 19:11379637-11379659 ATTGAGATGAGGGAGGTGACAGG - Intronic
1162816167 19:13196108-13196130 ATTTTGGAGAAGAAGGTGCCTGG + Intergenic
1163995310 19:21040079-21040101 ATTTGGAAGATGAAGGTGGGAGG - Intronic
1164001905 19:21108180-21108202 ATTTGGAAGATGAAGGTGGGAGG - Intronic
1164058575 19:21644866-21644888 ATTTGGAAGACAAAAGTGAGAGG - Intergenic
1164068174 19:21739310-21739332 ATTTGGAAGACAAAAGTGAGAGG + Intronic
1166080638 19:40442027-40442049 ATTTGGAAGAGGAGGAGGAGAGG - Exonic
1167419661 19:49395474-49395496 ATTTGGATGAGGAAGCAGAGGGG + Intronic
1167628258 19:50606601-50606623 ATGTGGACGTGGAAAGTGACTGG + Intergenic
925331540 2:3062611-3062633 CTTTGGAAGATGAAGATCACAGG + Intergenic
925742079 2:7014762-7014784 ATTTGAAAGAGGTAGGTGCCTGG + Exonic
925832476 2:7909927-7909949 ACTAGGAAGAGGGAGGTGAGTGG + Intergenic
927684072 2:25158718-25158740 GCTTGGAAGGGGAAGGTGACTGG - Exonic
927825675 2:26308311-26308333 ATTCACAAGAGGAAGATGACAGG - Intronic
928588749 2:32791371-32791393 ATGTGGAAGAGGAAGGAAAGGGG + Intronic
929644144 2:43610494-43610516 ATTTGGGAGATGAAGGTAACAGG + Intergenic
929823084 2:45289180-45289202 ATTTGCATGAGGAAGGTGGCAGG + Intergenic
929939451 2:46321784-46321806 ATTTGGGAGTGAAAGGTGTCAGG + Intronic
932050274 2:68391281-68391303 CAATGGAAGAGGAAGGTAACAGG - Intronic
932294786 2:70615339-70615361 TTGTGTAAGAGGAAGGTGTCTGG + Intronic
932755649 2:74407436-74407458 ATTTGGGAGTGGAAGGTGGGAGG - Intergenic
933887224 2:86729858-86729880 ATTTTGAATAGGGAGGGGACAGG + Intronic
933922952 2:87066855-87066877 ATTTTGAATAGGGAGGGGACAGG - Intergenic
934039184 2:88113917-88113939 AGTTAGAAGATGAAGGTGAAGGG + Intergenic
934511369 2:94946942-94946964 ATTGGGAAGAGGAAAGAGAGTGG - Intergenic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
936476381 2:112843510-112843532 TTATGGGACAGGAAGGTGACTGG + Intergenic
936738211 2:115472299-115472321 ATTTTGAAGAGGTCTGTGACAGG + Intronic
938027359 2:127961668-127961690 ATTTGGAGGCGGAAGGTGAGCGG + Intronic
938132186 2:128725974-128725996 ATTTTGAAGGTGGAGGTGACAGG + Intergenic
940039895 2:149349062-149349084 ATTTGGAAGAGGATCATGTCAGG + Intronic
940230129 2:151442315-151442337 ATTTGGAAGAGCAAGGCGGAGGG - Intronic
940624795 2:156160220-156160242 ATCTGGAAGAGGATGATGAAGGG + Intergenic
940735491 2:157446881-157446903 ATTTGGTAGAGTCAGGTGAGAGG + Intronic
941415363 2:165214037-165214059 ATTTGGAATAGGAATGTCAGTGG - Intergenic
943179158 2:184521310-184521332 AAATGGAAGAGGAAGGTGGATGG + Intergenic
945036198 2:205706080-205706102 AATTTGAAGAGGATGGTGAGCGG - Intronic
945268957 2:207919546-207919568 ATTTTGAAGCTGAAGCTGACAGG + Intronic
946204475 2:218093458-218093480 ATTTAGGAGAGGAGGGGGACGGG + Intergenic
946387970 2:219397222-219397244 ATGTGGAACAGGAAAGAGACGGG - Intronic
946467943 2:219929236-219929258 ATAGAGAAGAGGAAGTTGACTGG + Intergenic
946873494 2:224106129-224106151 ATTTGAAAGAGGAAGGAAAATGG - Intergenic
947079487 2:226380335-226380357 ATTTGGAAAAGGAAATTGATTGG - Intergenic
947288726 2:228547233-228547255 TTTTGGGAGAGGGAGGTGACTGG + Intergenic
947586125 2:231358069-231358091 CTTAGGCAGAGGCAGGTGACAGG - Intronic
948469602 2:238168459-238168481 AGTTAGAAGGTGAAGGTGACTGG - Intronic
948855306 2:240727527-240727549 ATTGGGAAGAGGAAGGCCCCGGG + Intronic
948916958 2:241039303-241039325 CTTTGGCATAGGAAGGAGACAGG - Intronic
1168751059 20:281733-281755 CTTTGGAAGAGCAAGGTGGAAGG + Intronic
1170469281 20:16652451-16652473 ATTAGTAAGTGGAATGTGACTGG + Intergenic
1170733822 20:18996376-18996398 ATTTGGAAGAGAAGGGGGAGGGG + Intergenic
1172278993 20:33697535-33697557 ATTTGGGAGAGGAAGCTGTCAGG + Intergenic
1173437774 20:43048270-43048292 ATATGGAAGAGGCTGGTGCCAGG + Intronic
1173489296 20:43466639-43466661 ATTTGGGAGAGGAAGTAGACAGG - Intergenic
1173833688 20:46110969-46110991 ATTAGGAAGAGCAAGGGGAAAGG + Intergenic
1174108957 20:48184556-48184578 ATGTTGGAGAGGAAGATGACAGG - Intergenic
1174503821 20:51004196-51004218 GTGTGGAAGATGGAGGTGACTGG + Exonic
1176066347 20:63198294-63198316 ATTTGGCAGGGCATGGTGACCGG + Intronic
1176291039 21:5044786-5044808 GTTGGGAAGAGGATGGTGGCGGG + Intergenic
1176513815 21:7768322-7768344 ATTTGGAAGGCCAAGGTGAAAGG - Intronic
1178062972 21:28872529-28872551 CTATGAAAGAGAAAGGTGACAGG - Exonic
1178361279 21:31950274-31950296 TATGGGAAGAGGAAGGTGTCAGG + Intronic
1178647928 21:34398846-34398868 ATTTGGAAGGCCAAGGTGAAAGG - Intronic
1178762890 21:35421087-35421109 TTTTCGAAGAGGAAGGGAACTGG + Intronic
1179117228 21:38504750-38504772 ATTTGGCCAAGGATGGTGACAGG - Intronic
1179129928 21:38626163-38626185 CTTTGGGAGACCAAGGTGACTGG - Intronic
1179239217 21:39574137-39574159 ATTTGGAAGAAGCAAGTGAATGG - Intronic
1179866216 21:44218855-44218877 GTTGGGAAGAGGATGGTGGCGGG - Intergenic
1179955260 21:44734901-44734923 AATTGGAAGAGGACGGGGCCGGG - Intergenic
1180084561 21:45502050-45502072 CTTCGGCAGAGGGAGGTGACCGG - Intronic
1180703365 22:17793869-17793891 ATTTGGAAGTGGAGAGGGACAGG + Intronic
1182087999 22:27574673-27574695 AAGGGGAAGAGGAAGGAGACAGG + Intergenic
1182506687 22:30788240-30788262 AGTAGGAAGAGGAAGAGGACGGG + Intronic
1182534534 22:30990793-30990815 ATTTGAAATAAGAAGGGGACAGG - Intergenic
1183166950 22:36155402-36155424 AATAGGAAGAGGGAGGTGAGAGG - Intronic
1184436164 22:44478640-44478662 ATCTGGAAGAGGAAAGTCAGAGG - Intergenic
950243857 3:11396821-11396843 ACTTGGAGGAGGTAGGTGATTGG + Intronic
952857484 3:37784237-37784259 ATTTGGAAGAAGACAGGGACTGG - Intronic
953043408 3:39274582-39274604 ATTTTGAAGAGGAAAGGGAAGGG - Intronic
953756751 3:45653230-45653252 ATTTGGATGAGGAGGGAGAGAGG + Intronic
954645856 3:52131132-52131154 ATTTGGGAGAGGATGGTGGGCGG - Intronic
954837807 3:53485515-53485537 TTTTTGAAGAGGAAGGTTATGGG - Intergenic
955924922 3:63995346-63995368 ATTTGAAGGAGAGAGGTGACAGG + Intronic
956361359 3:68451560-68451582 AGATGGAAGGGGAAGATGACAGG - Intronic
957510381 3:81180463-81180485 ATTTAGAAGAAAAAGGTGAAGGG + Intergenic
957521971 3:81329788-81329810 ATTTGGAGCATGAAGGTGATTGG + Intergenic
958531364 3:95335789-95335811 ATTTGGAAGAAAAAGCTGACAGG - Intergenic
958662988 3:97095491-97095513 ATTTTGAAAAGGAAGGTGGGGGG - Intronic
958688381 3:97428309-97428331 CTTTGAAAGAGGGAGGAGACTGG + Intronic
959440276 3:106365800-106365822 ATATGGAAGATGCTGGTGACAGG + Intergenic
961569202 3:127786058-127786080 ATGTGGAGGAGGAAGGTGAGAGG + Intronic
962066790 3:131989969-131989991 ATTTGGAAGGGGAATGTTGCTGG + Intronic
963209140 3:142669153-142669175 ATTTGGGAGACTAAGGTGAGGGG - Intronic
963390914 3:144663130-144663152 ATTTGTAAGAGGAGGGAGGCAGG - Intergenic
963933543 3:151028873-151028895 ATTAGGAAGAGGAAGGGGAAAGG - Intergenic
964261739 3:154847213-154847235 ATTGGGAAGAGGAAAAAGACGGG + Intergenic
964514117 3:157488806-157488828 ATTTGGAAAGGGAGGGTGAGGGG - Intronic
964959237 3:162403727-162403749 CTTTGGAAGAGGAAGGGTCCAGG + Intergenic
965215885 3:165864365-165864387 ATTTGGCAAAGGAAAGTGAAGGG - Intergenic
965450810 3:168835464-168835486 ATGTAGAAGATAAAGGTGACTGG + Intergenic
965798007 3:172461577-172461599 ATTTTGAAGAGGAAGGTAGGGGG - Intergenic
966052696 3:175640246-175640268 ATTAATAAGAGAAAGGTGACAGG + Intronic
966928129 3:184658759-184658781 AGTTGGAAGAGGAAGGAACCTGG + Intronic
967148987 3:186630981-186631003 ATTTGGAAGGGGGAGGGGATGGG - Intergenic
967201293 3:187074689-187074711 ATTTGGCAGAGGAAGATGGAGGG + Intronic
968500687 4:948449-948471 GGTTGGAAGAGGAAGGTTCCGGG + Intronic
969486740 4:7476562-7476584 TATTGGCAGAGAAAGGTGACAGG - Intronic
970288455 4:14545100-14545122 ATTTGGGGGTGGGAGGTGACAGG + Intergenic
970390782 4:15610698-15610720 ATTGGGTAGAGGGAGGGGACTGG - Intronic
971666743 4:29496740-29496762 ATTAGGGAGAGGGAGCTGACAGG - Intergenic
971723942 4:30283822-30283844 ATTTCAAACAGGAAGATGACTGG + Intergenic
971894330 4:32572040-32572062 ACTTGGGAGATCAAGGTGACAGG + Intergenic
972079999 4:35138709-35138731 ATTTGGAAAATGAAATTGACAGG - Intergenic
972341119 4:38153599-38153621 TATAGGAAGAGGAAGCTGACAGG - Intergenic
972402290 4:38716701-38716723 ATTTGGTGGAGGCAGGTGAGAGG + Intergenic
973157771 4:46978442-46978464 ATTTGGGAGACTAAGGTGAGAGG + Intronic
973228972 4:47820082-47820104 ATTTGAAAGAAGAATGTGTCGGG - Intronic
974611951 4:64229098-64229120 TTTTGGGGGAGGAAGGTGGCTGG + Intergenic
974864257 4:67561325-67561347 ATTGGCTAGAGGAAGGTGAGAGG + Intronic
975888617 4:78996526-78996548 ACTTGAAAGAGTAAGGAGACTGG + Intergenic
976578554 4:86706108-86706130 ATTTGGAAGTGGAAGGAATCTGG + Intronic
977371171 4:96138596-96138618 TTGTGGAAGAGCAAGTTGACAGG + Intergenic
978392532 4:108242149-108242171 ATTAGGAGGAGGAAGGAGATTGG + Intergenic
978784978 4:112599476-112599498 CTTTGGAAGACCAAGGTGAGAGG + Intronic
980021414 4:127714486-127714508 GGATGGAAGAGGAAGGAGACAGG - Intronic
980106911 4:128596529-128596551 GTTTGGAGAAGGAAGGTGATGGG - Intergenic
980788927 4:137593502-137593524 ATTTGGAAAAGAAAGGGGATAGG + Intergenic
981594157 4:146400229-146400251 ATTTGGAAGATGGAGGTCACTGG + Intronic
981623087 4:146725979-146726001 ATTTGGGAGACTGAGGTGACAGG - Intronic
982437138 4:155392797-155392819 ATATTGAAGAGGAAGGCGGCAGG + Intergenic
982652152 4:158099596-158099618 ATTTTGAACAAGGAGGTGACTGG - Intergenic
983919426 4:173329964-173329986 ATTTGGTAGAGGTAGGGAACTGG + Intergenic
984557196 4:181228681-181228703 ATTTAGAAAAGGAAACTGACAGG - Intergenic
984742542 4:183179653-183179675 ATTTGGGGGAGGAATGGGACTGG + Intronic
985500436 5:240742-240764 ACTTGGAAGTGGAAGCTGAATGG - Intronic
985648020 5:1094120-1094142 TTTTAGAAGAAGAAGGTGCCAGG - Intronic
985658846 5:1145580-1145602 ATTTGAAACAGGAAGGTCCCTGG + Intergenic
985954577 5:3254196-3254218 ATTTGGAAGAAGAGAGTGTCTGG + Intergenic
986211995 5:5682660-5682682 ACTAGGAAGGGGAAGGTGAAGGG + Intergenic
986383573 5:7209163-7209185 ATCTGGAACAGGAAGCTGAGGGG - Intergenic
987083905 5:14450950-14450972 ATATGTAAGAGCAAGGTAACTGG + Intronic
987101205 5:14592711-14592733 ATATGGAAGAGGAATCAGACTGG + Intronic
987830132 5:23085186-23085208 ATTTGGAAGAGAGAGGTTAGTGG + Intergenic
987971072 5:24945305-24945327 ATTTGGCAGGGGAGGGTGGCGGG - Intergenic
988194456 5:27984870-27984892 TGTTGGAAGAGGAAGGTGATTGG - Intergenic
988839184 5:35066585-35066607 ATTAGGAAGAGGGAGGAGAAGGG - Intronic
988867981 5:35356331-35356353 GTGTAGAAAAGGAAGGTGACTGG - Intergenic
990025018 5:51177207-51177229 AGTTGAAAGAGAAAAGTGACGGG + Intergenic
990299238 5:54434123-54434145 AAGAGGAAGAGGAAGGTAACTGG + Intergenic
990598562 5:57334699-57334721 CTTTGGTAGAGGAAGGTGGCTGG - Intergenic
990705801 5:58528195-58528217 ATTTGGATGAGGAAAGGGATTGG - Intergenic
990881414 5:60543207-60543229 ATGTGGAAGAGGAAGGACACTGG - Intergenic
991511210 5:67378399-67378421 ATTTAGATGAAGAAGGAGACTGG - Intergenic
991513054 5:67401236-67401258 AGTTGGAAAAGGAATGGGACTGG + Intergenic
994833270 5:104813577-104813599 AGTTGGAAGAGGAAGGTGGGAGG - Intergenic
995002573 5:107152451-107152473 TTTTGGAAGAGGGAGCTGCCAGG - Intergenic
995192985 5:109339278-109339300 ATTTGGAAGAGTGAGGGGATAGG + Intronic
995708244 5:115007692-115007714 CTTTGGAAGAGGAAGAAGGCAGG + Intergenic
996396209 5:123016707-123016729 ATTTGGATGTGGAAGGTAAAGGG + Intronic
996825078 5:127673766-127673788 ATGAGTAAGAGGAAGGTGACTGG + Intergenic
996870383 5:128185204-128185226 ATTTTCAAGAGGAAGCTGTCCGG - Intronic
997219360 5:132147563-132147585 ACTTGGAAGAGGATGATGAGTGG - Intergenic
997298135 5:132782397-132782419 ATTCAGAAGAGGAAGAAGACAGG + Intronic
997862281 5:137428761-137428783 ATTAGGAAGAGGGAGGTGTTAGG - Intronic
999050373 5:148517609-148517631 AATTAGAAGAGGAATGTGAAAGG - Intronic
999759239 5:154687724-154687746 CTTTGGAAGGCGAAGGTGGCAGG + Intergenic
1000790988 5:165607051-165607073 ATTTGAAGGAGGAAGGTGAGAGG - Intergenic
1000874573 5:166620109-166620131 ATTTGGATGGGGAAAGTGAAGGG + Intergenic
1001241891 5:170077628-170077650 AGGTGGAGGAAGAAGGTGACAGG + Intronic
1002802960 6:543800-543822 TTTTGAAGGAGGAAGATGACTGG + Intronic
1005438101 6:25836560-25836582 ATTTGGAGGAGGAAGGTTAGGGG + Intronic
1005560834 6:27039278-27039300 TTGTGGAAGAGGAAGGTGCCAGG - Intergenic
1006362352 6:33593620-33593642 ATCAGGAGGAGGAAGTTGACAGG + Intergenic
1006366450 6:33619095-33619117 ATTTGGAAGAAGCAGGTGACAGG + Intergenic
1006633181 6:35443692-35443714 ATCTTGAAGAGGAAGGGGAATGG - Intergenic
1008418288 6:51268313-51268335 ATTTTGAAAAGTAAGGTGGCTGG + Intergenic
1011041763 6:83037161-83037183 ATTTGGAGGCAGCAGGTGACAGG - Intronic
1011441431 6:87391298-87391320 ACTTTGAAGAGAAAGGTGCCAGG + Intronic
1011626793 6:89289677-89289699 ATCTGGAAGGGGAAGGGGAAGGG + Intronic
1013079700 6:106801522-106801544 ATTTTGAAGAAGAAAATGACAGG + Intergenic
1013296614 6:108763420-108763442 ACTGGGAAGAGGAAGGTTATGGG - Intergenic
1013539032 6:111088713-111088735 ACTAGGATGAGGAAGGTGAAGGG + Intronic
1014033378 6:116736360-116736382 AGTTGGAAATGGGAGGTGACTGG + Intronic
1014426533 6:121313507-121313529 ATTTGGAAGAGGAATGTGTAGGG - Intronic
1014629318 6:123770105-123770127 ATTTGCAAGAGGTAGATTACTGG + Intergenic
1014872956 6:126619021-126619043 TTTGGAAAGAGGATGGTGACAGG + Intergenic
1015098391 6:129445694-129445716 ATTTAGAACAGGAAGCTGACCGG + Exonic
1015718713 6:136218194-136218216 ATTTGGAAGAGGATACTGATGGG - Intergenic
1016273143 6:142314341-142314363 ATTAGGAAGAGGGAGATGTCAGG + Intronic
1018247693 6:161838600-161838622 ATGAGGAAGAGGAAGGTGGCTGG - Intronic
1018786358 6:167111077-167111099 ATTTGAAAAAGGAAGGAGAGGGG + Intergenic
1020394942 7:7704058-7704080 AGTTGGAAAAGGAAGATGTCTGG - Intronic
1021826422 7:24557076-24557098 ATTTGGAAGATGGAGGCGGCTGG + Intergenic
1023069457 7:36414539-36414561 CTTAGGAAAGGGAAGGTGACAGG + Intronic
1023666240 7:42526352-42526374 GATTGGAAGAGGGAGGAGACAGG + Intergenic
1024608511 7:51042954-51042976 TTCTAGAAGAGGAAAGTGACAGG - Intronic
1024740133 7:52344479-52344501 GTTTTAAAGAGGAGGGTGACAGG + Intergenic
1024751208 7:52467520-52467542 ATTTATCAGAGGAAGGTCACTGG - Intergenic
1028267313 7:88742248-88742270 ATTTGGAGGAGGCAGGGGATGGG - Intergenic
1028587599 7:92467486-92467508 ATTTGGAAGAGGAAGGATGTGGG + Intergenic
1029261420 7:99305304-99305326 ATTCTGGGGAGGAAGGTGACAGG - Intergenic
1030660753 7:112216689-112216711 ATTTGGAAGATGGAGTTGAAAGG - Intronic
1031200987 7:118685093-118685115 GTTTGGAAGAGGAAGATTAGAGG + Intergenic
1031690846 7:124785988-124786010 ATGTTGCAGATGAAGGTGACAGG - Intronic
1032265918 7:130369909-130369931 ATTTGGTAGAAGAAGGGGATGGG + Intergenic
1032894133 7:136232248-136232270 ATTTGAGAGAGGCAGGTAACTGG - Intergenic
1035156926 7:156921665-156921687 ATGAGGAAGAGGAAGGTCTCTGG - Intergenic
1035355900 7:158276102-158276124 AGATGGAAGAGGAAGCTGAGAGG - Intronic
1036597796 8:10229829-10229851 ATTTGGAAGAGGAAAGGGAGAGG + Intronic
1037177998 8:15969866-15969888 ATTTGGAAGTAGCAGGTAACAGG + Intergenic
1038300027 8:26335994-26336016 GAATGGAAGAGGAAGGTGAAGGG - Intronic
1038503217 8:28062740-28062762 ATGGGGAATATGAAGGTGACGGG - Intronic
1038780940 8:30568132-30568154 TTTTTGAAGATGAAGCTGACAGG + Intronic
1039194538 8:35016153-35016175 ATTTGGAAGGCCAAGGTGAGTGG + Intergenic
1040003362 8:42597687-42597709 AGTTGGAGGTGGGAGGTGACTGG - Intergenic
1042392331 8:68250245-68250267 ATTTGAAAGAAGGAGGGGACAGG - Intergenic
1043850135 8:85206448-85206470 GTGTGGAAGGGGAAGGGGACAGG + Intronic
1045342427 8:101266652-101266674 ATACGGAATAAGAAGGTGACTGG - Intergenic
1045931389 8:107630994-107631016 GTTTAGCTGAGGAAGGTGACTGG + Intergenic
1046305798 8:112365210-112365232 ATATTGAAGAGGAAGGAGGCAGG - Intronic
1047189109 8:122661858-122661880 AGTTAGTGGAGGAAGGTGACTGG - Intergenic
1047832403 8:128649324-128649346 ACTTGGTAGAGGAAGGGGTCAGG + Intergenic
1048222537 8:132555122-132555144 CTGAGGAAGAGGAAGGAGACAGG - Intergenic
1048519791 8:135142857-135142879 GTTTGAAAGAGGAAGATGAAGGG + Intergenic
1048543535 8:135365029-135365051 ATTGGGAAGAGGACGGAGATGGG - Intergenic
1048691235 8:136966333-136966355 AATTGGGAGAGGAAGGAGACAGG - Intergenic
1048905001 8:139079265-139079287 ATATGGCAGAGAAAGCTGACTGG + Intergenic
1050546815 9:6716335-6716357 ATTAGAGAGAGGAACGTGACTGG + Intergenic
1050667691 9:7959769-7959791 TGTAGGAAGAGGAAGGAGACAGG - Intergenic
1050673824 9:8028952-8028974 AATTGGAGAAGGAACGTGACTGG - Intergenic
1051489706 9:17647912-17647934 AGGTGGAAGAGGAAGGTGGGGGG - Intronic
1051819872 9:21151920-21151942 ATTTGGAAGACCAAGGTGGGAGG - Intergenic
1052265314 9:26565277-26565299 ATTTGGAGGAGGCAGGTGTTGGG - Intergenic
1053276947 9:36790342-36790364 ATTTGGAAATGGAAGGGGAAGGG + Intergenic
1053550479 9:39074270-39074292 ATTTGGGAGACCAAGGTGAGAGG - Intronic
1054975136 9:71134633-71134655 ATTTGTAAGACTAAGGTGACAGG - Intronic
1055362883 9:75513108-75513130 ATATGAAGAAGGAAGGTGACTGG - Intergenic
1055660040 9:78494054-78494076 ATTTGGAAAAGAGAGGTCACAGG + Intergenic
1056848646 9:90062101-90062123 ATAGGGAAGAGGTAGGTGGCAGG - Intergenic
1057398171 9:94698973-94698995 AATTGGAAGAAGAATGTGAAGGG + Intergenic
1058139470 9:101342445-101342467 AGGGGGAAGAGGAAGGGGACGGG + Intergenic
1059179117 9:112195376-112195398 CTTTGGAAGACCAAGGTGTCTGG + Intergenic
1059604033 9:115813488-115813510 ATCTGGGATAGGAAGGTAACAGG - Intergenic
1059794471 9:117677340-117677362 ATTTGGAAGAGGAAGGGGTGGGG + Intergenic
1059897135 9:118878836-118878858 ATTTGGAGAAGGAAGGGGAGAGG - Intergenic
1061116840 9:128618918-128618940 ATGTGGAAGAGGAAGAAGCCTGG + Exonic
1062658593 9:137616632-137616654 ATTTCCAACAGGAAGGGGACAGG - Intronic
1185568278 X:1113359-1113381 CTTTGGGAGAGGAAGGCGGCTGG + Intergenic
1185735737 X:2494466-2494488 ATTTGGCTGAGAAAGGTGCCAGG + Intronic
1186024650 X:5296033-5296055 ATTTGGAAGACGAAGGTGGGAGG + Intergenic
1186657780 X:11633626-11633648 ATGTGGAAGTGGAAGGCGTCTGG + Intronic
1187214305 X:17261327-17261349 TTTTGGAAGGGGAAGGGTACAGG + Intergenic
1187477197 X:19622159-19622181 ATTTGTAATATGAAGATGACAGG + Intronic
1188370581 X:29365294-29365316 ATATGGAAGTGGTAGGAGACAGG + Intronic
1188880408 X:35485314-35485336 ATTGGCAAGTGGAAGGTGAATGG + Intergenic
1188918805 X:35946114-35946136 ATTTGGAAGACGGAGGTGGGAGG - Intronic
1189337640 X:40180019-40180041 AGTTGGATGAGGAAGAGGACAGG - Intergenic
1191123484 X:56929890-56929912 ACTTGAATGAGGAAGGTGAGAGG - Intergenic
1192360774 X:70437700-70437722 ATTTGGAAGGGAGAGCTGACAGG - Intergenic
1195297231 X:103490767-103490789 CTTTGGAAGACGGAGGTGAGCGG - Intergenic
1195598704 X:106722131-106722153 GTTTGGAAGAGGAGGGTGGAAGG + Intronic
1196088953 X:111718332-111718354 ATTTGAAAGTGGAAGGGGCCTGG + Intronic
1196131285 X:112159755-112159777 ATTTGGAAGAGTGGGGAGACGGG - Intergenic
1196872400 X:120125442-120125464 ATGTGGAACTGGAAGGAGACAGG + Intergenic
1197063081 X:122205346-122205368 ATTTGTGATAGGAAGGTGAGGGG - Intergenic
1198502039 X:137259944-137259966 AGTGGAAAGAGGAAGGGGACTGG - Intergenic
1200156540 X:153979461-153979483 ATTTGGAAGGCCAAGGTGAGAGG - Intronic
1200337647 X:155366917-155366939 CTCTGGAAGAGGAATGTGATGGG - Intergenic
1200348823 X:155474310-155474332 CTCTGGAAGAGGAATGTGATGGG + Intergenic
1201774197 Y:17646109-17646131 ATCTGGAAGAGGCCAGTGACTGG + Intergenic
1201827360 Y:18259880-18259902 ATCTGGAAGAGGCCAGTGACTGG - Intergenic
1201897840 Y:19012548-19012570 CTTTGGGAGATGAAGGTGAGAGG + Intergenic