ID: 1075081475

View in Genome Browser
Species Human (GRCh38)
Location 10:119386816-119386838
Sequence CAGAGGAGGGAGGAGGTGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075081464_1075081475 -6 Left 1075081464 10:119386799-119386821 CCATCCTGACTGGAACCCAGAGG 0: 1
1: 0
2: 3
3: 30
4: 236
Right 1075081475 10:119386816-119386838 CAGAGGAGGGAGGAGGTGGCGGG No data
1075081462_1075081475 6 Left 1075081462 10:119386787-119386809 CCGTTTTTTCTTCCATCCTGACT 0: 1
1: 0
2: 13
3: 161
4: 1658
Right 1075081475 10:119386816-119386838 CAGAGGAGGGAGGAGGTGGCGGG No data
1075081467_1075081475 -10 Left 1075081467 10:119386803-119386825 CCTGACTGGAACCCAGAGGAGGG 0: 1
1: 0
2: 0
3: 37
4: 283
Right 1075081475 10:119386816-119386838 CAGAGGAGGGAGGAGGTGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075081475 Original CRISPR CAGAGGAGGGAGGAGGTGGC GGG Intronic
No off target data available for this crispr