ID: 1075081923

View in Genome Browser
Species Human (GRCh38)
Location 10:119390057-119390079
Sequence GCATCCAACCAAGGATCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 75}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075081923_1075081926 4 Left 1075081923 10:119390057-119390079 CCTTTAGATCCTTGGTTGGATGC 0: 1
1: 0
2: 1
3: 4
4: 75
Right 1075081926 10:119390084-119390106 ACAGAGAAACAATTCTGAGAGGG No data
1075081923_1075081931 27 Left 1075081923 10:119390057-119390079 CCTTTAGATCCTTGGTTGGATGC 0: 1
1: 0
2: 1
3: 4
4: 75
Right 1075081931 10:119390107-119390129 AAGGAGGAAAAGCAGCTGGTGGG No data
1075081923_1075081933 29 Left 1075081923 10:119390057-119390079 CCTTTAGATCCTTGGTTGGATGC 0: 1
1: 0
2: 1
3: 4
4: 75
Right 1075081933 10:119390109-119390131 GGAGGAAAAGCAGCTGGTGGGGG No data
1075081923_1075081932 28 Left 1075081923 10:119390057-119390079 CCTTTAGATCCTTGGTTGGATGC 0: 1
1: 0
2: 1
3: 4
4: 75
Right 1075081932 10:119390108-119390130 AGGAGGAAAAGCAGCTGGTGGGG No data
1075081923_1075081929 23 Left 1075081923 10:119390057-119390079 CCTTTAGATCCTTGGTTGGATGC 0: 1
1: 0
2: 1
3: 4
4: 75
Right 1075081929 10:119390103-119390125 AGGGAAGGAGGAAAAGCAGCTGG No data
1075081923_1075081928 11 Left 1075081923 10:119390057-119390079 CCTTTAGATCCTTGGTTGGATGC 0: 1
1: 0
2: 1
3: 4
4: 75
Right 1075081928 10:119390091-119390113 AACAATTCTGAGAGGGAAGGAGG No data
1075081923_1075081925 3 Left 1075081923 10:119390057-119390079 CCTTTAGATCCTTGGTTGGATGC 0: 1
1: 0
2: 1
3: 4
4: 75
Right 1075081925 10:119390083-119390105 GACAGAGAAACAATTCTGAGAGG No data
1075081923_1075081927 8 Left 1075081923 10:119390057-119390079 CCTTTAGATCCTTGGTTGGATGC 0: 1
1: 0
2: 1
3: 4
4: 75
Right 1075081927 10:119390088-119390110 AGAAACAATTCTGAGAGGGAAGG No data
1075081923_1075081930 26 Left 1075081923 10:119390057-119390079 CCTTTAGATCCTTGGTTGGATGC 0: 1
1: 0
2: 1
3: 4
4: 75
Right 1075081930 10:119390106-119390128 GAAGGAGGAAAAGCAGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075081923 Original CRISPR GCATCCAACCAAGGATCTAA AGG (reversed) Intronic
908092002 1:60696176-60696198 CCATGCAACCAAAGAGCTAATGG - Intergenic
908407437 1:63829178-63829200 GAATCAAACAAAGGATCCAAGGG - Intronic
909112193 1:71493465-71493487 GAATCCAAACAAGGATTCAAGGG - Intronic
910723181 1:90310207-90310229 GCATACACACAAGGATCTCATGG - Intergenic
911998543 1:104799218-104799240 GCATACAATCAAGTAGCTAATGG - Intergenic
919051338 1:192515038-192515060 GCATGAAACCAAGTATATAACGG - Intergenic
1063104589 10:2981954-2981976 GCTTCCCACCTAGGATGTAAGGG + Intergenic
1066534797 10:36380274-36380296 TCATCCAACCAGTGATCCAATGG - Intergenic
1067271837 10:44798432-44798454 GAATCCAACAAATGATATAATGG + Intergenic
1073452638 10:103618784-103618806 GCATCCAGCCAAGGAGCCCAGGG - Intronic
1075081923 10:119390057-119390079 GCATCCAACCAAGGATCTAAAGG - Intronic
1075775447 10:124982498-124982520 GCATGAAACCAAGAGTCTAAGGG - Intronic
1075927964 10:126268532-126268554 GCATGCAACAAATGAGCTAATGG + Intronic
1080668101 11:34353701-34353723 TCTTCCAACCAAGAATTTAAGGG - Intronic
1094047573 12:26184052-26184074 GCTTCCAACCAATGAGCTAGAGG + Intronic
1103544460 12:121690031-121690053 GCAGCCAAACAAGGATCCAGGGG - Intergenic
1105898468 13:24738293-24738315 TCATCCAACCCAGTATCTGATGG + Intergenic
1106079367 13:26487805-26487827 AGCTCCAACCAAGGATCTGAAGG - Intergenic
1115333103 14:32219387-32219409 GCATGCAAATCAGGATCTAACGG - Intergenic
1115803824 14:37028614-37028636 GCATCCATCCAGGGTTGTAATGG - Intronic
1118920495 14:70145598-70145620 GCATCAAACCTATCATCTAAGGG - Intronic
1120980918 14:90288265-90288287 GCAAACAACCAAGGCTCCAAGGG + Exonic
1121907217 14:97757503-97757525 GCCTCCAAGGAAGGATCTGACGG - Intronic
1129249260 15:74299618-74299640 GCATCCAGCCAAGGAAATACTGG + Intronic
1132107827 15:99076796-99076818 GGAAGCAACCAAGGATCGAACGG - Intergenic
1141753379 16:85974852-85974874 GCCTCCAACCAAGGACCTTCTGG - Intergenic
1146150579 17:30466167-30466189 GCATCTTACCAATGATGTAACGG + Exonic
1151544876 17:74786610-74786632 GCATCTAAGCAAGGATCTGAAGG + Intronic
1153436301 18:5071536-5071558 GCATTCAACCAAGAACCCAAGGG + Intergenic
1168455569 19:56505596-56505618 TCATCCCACCAAGGAAGTAAGGG - Intergenic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
931047492 2:58372720-58372742 GAATCTAAACAAGCATCTAAAGG - Intergenic
932720461 2:74135038-74135060 GCCTCCTACCAAGAATCAAAGGG + Intronic
934216731 2:90038019-90038041 CCATCCACCCCAGGATCTCAGGG - Intergenic
938165668 2:129024044-129024066 GAATCTAACCAAGGAGTTAATGG - Intergenic
938766559 2:134463854-134463876 GCATCAAACCCAGGACCTGACGG + Intronic
943761108 2:191610337-191610359 ACATCCAATCAAGGATCCACTGG - Intergenic
948439848 2:237979648-237979670 CCCTCCAACAAAGCATCTAAAGG - Intronic
1169203948 20:3729874-3729896 GCACCCACACAAGGGTCTAAGGG + Intergenic
1174993678 20:55542038-55542060 TCATCAAAGCAAGGATGTAAAGG + Intergenic
1180222222 21:46366201-46366223 GCATCCAACCAAGAATCCCAAGG - Intronic
1180871010 22:19147498-19147520 CCATTCAACCAAGGAACTCAAGG + Intergenic
1182362711 22:29756409-29756431 GCTGCCACCCAAGGATCTCAAGG - Intronic
1185416668 22:50714392-50714414 CCATCCAACCAGGGCTCTGATGG + Intergenic
960632708 3:119749164-119749186 GAATTCAACCAAGGGTGTAATGG - Intronic
964267953 3:154921419-154921441 GACTCCAACCATGGATCAAAGGG - Intergenic
970010286 4:11451020-11451042 ACATCCAAACAAGGATGTCAAGG - Intergenic
970749605 4:19341955-19341977 GCATCTCAACAAGGATATAAAGG - Intergenic
972821850 4:42710819-42710841 CTATCAAACCAAGTATCTAATGG + Intergenic
974492317 4:62582800-62582822 ACATCCCACAAAGGATTTAAAGG + Intergenic
979794130 4:124823791-124823813 TCATCTAACCTAGGACCTAAGGG + Intergenic
981596240 4:146425989-146426011 GCATCAAGCCAAGTGTCTAAAGG + Intronic
982466474 4:155739359-155739381 GCCTCCCACCTAGCATCTAAAGG - Intergenic
983015287 4:162605965-162605987 GAATCCAACAAGGGACCTAATGG + Intergenic
986651590 5:9969133-9969155 GCATCCAAAGAAAGATATAAAGG + Intergenic
988303632 5:29466547-29466569 GCATCCATCCTATGATGTAATGG - Intergenic
993245192 5:85442041-85442063 GAATCCAAACAAGGATCTAATGG + Intergenic
999988192 5:157024577-157024599 GCATCAAACCCATGATTTAATGG - Intergenic
1001649108 5:173302587-173302609 GCCTCCAGCCATGGATCTGAGGG - Intergenic
1002950791 6:1809219-1809241 GAATCCAATCAAGAATATAAAGG + Intronic
1005908605 6:30288201-30288223 GCAGCTAACCAAGGAAGTAAAGG - Intergenic
1007608745 6:43135023-43135045 GCTTCCAACCCAGGCTCTAGGGG + Intronic
1009130805 6:59465547-59465569 GTTTCCAACGAAGGACCTAAAGG - Intergenic
1010213822 6:73384347-73384369 GAATCCAACCAAGTATTTAAAGG + Intronic
1010956870 6:82100362-82100384 GCATCTGACAAAGGAACTAAAGG + Intergenic
1011389263 6:86833790-86833812 TCATCCAAGCAAGAATTTAAAGG + Intergenic
1018547593 6:164954991-164955013 GCATCCAGCCAAGGGTCTTTTGG + Intergenic
1026560259 7:71442862-71442884 GCATCCTACCAAGTGTATAAAGG - Intronic
1042706678 8:71670663-71670685 GCTACCAACCAAGGAGCTGATGG - Intergenic
1046181863 8:110659921-110659943 GCATTCAACCAAGGAGGTGAAGG + Intergenic
1050727555 9:8669161-8669183 GCATCCAACCAAGGAATAAGAGG - Intronic
1051576903 9:18626367-18626389 GCATTTAAACAAGGATCTAAGGG + Intronic
1056578907 9:87876315-87876337 GCTTCAAAGCCAGGATCTAAGGG + Intergenic
1187268370 X:17757967-17757989 GCATCCAGCCAAGGAAAAAAGGG + Intergenic
1187469005 X:19551827-19551849 GCATCCATCCAAGTGTGTAATGG - Intronic
1188230019 X:27650506-27650528 ACATCTAACCAAGGAGGTAAAGG - Intronic
1189907759 X:45779396-45779418 GCATTTAAACAAAGATCTAAAGG + Intergenic
1192351632 X:70360971-70360993 ACATCCAGCCTAGGATCTAGGGG - Intronic
1193621477 X:83757116-83757138 GCTTCCAACCAATGAGCTAGAGG + Intergenic
1196646929 X:118128008-118128030 TCATCCAAGCAAAGATCTGAGGG + Intergenic
1201071395 Y:10150279-10150301 GTATCCAGACAAGGAGCTAAAGG - Intergenic