ID: 1075083713

View in Genome Browser
Species Human (GRCh38)
Location 10:119400414-119400436
Sequence CTTGTAATTGGCAGAATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075083704_1075083713 23 Left 1075083704 10:119400368-119400390 CCTTCATGGGTGCAGTGCAGTGG No data
Right 1075083713 10:119400414-119400436 CTTGTAATTGGCAGAATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075083713 Original CRISPR CTTGTAATTGGCAGAATTGT GGG Intronic
No off target data available for this crispr