ID: 1075084067

View in Genome Browser
Species Human (GRCh38)
Location 10:119402390-119402412
Sequence CTGTAGAACTGGAGGGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 1, 2: 3, 3: 25, 4: 228}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075084067_1075084077 15 Left 1075084067 10:119402390-119402412 CCTTCTACCCTCCAGTTCTACAG 0: 1
1: 1
2: 3
3: 25
4: 228
Right 1075084077 10:119402428-119402450 GGTGACAGGTATTCAGGAGAGGG No data
1075084067_1075084074 1 Left 1075084067 10:119402390-119402412 CCTTCTACCCTCCAGTTCTACAG 0: 1
1: 1
2: 3
3: 25
4: 228
Right 1075084074 10:119402414-119402436 CCAGAAGTGATACAGGTGACAGG No data
1075084067_1075084076 14 Left 1075084067 10:119402390-119402412 CCTTCTACCCTCCAGTTCTACAG 0: 1
1: 1
2: 3
3: 25
4: 228
Right 1075084076 10:119402427-119402449 AGGTGACAGGTATTCAGGAGAGG No data
1075084067_1075084071 -6 Left 1075084067 10:119402390-119402412 CCTTCTACCCTCCAGTTCTACAG 0: 1
1: 1
2: 3
3: 25
4: 228
Right 1075084071 10:119402407-119402429 CTACAGCCCAGAAGTGATACAGG No data
1075084067_1075084075 9 Left 1075084067 10:119402390-119402412 CCTTCTACCCTCCAGTTCTACAG 0: 1
1: 1
2: 3
3: 25
4: 228
Right 1075084075 10:119402422-119402444 GATACAGGTGACAGGTATTCAGG No data
1075084067_1075084079 19 Left 1075084067 10:119402390-119402412 CCTTCTACCCTCCAGTTCTACAG 0: 1
1: 1
2: 3
3: 25
4: 228
Right 1075084079 10:119402432-119402454 ACAGGTATTCAGGAGAGGGGAGG No data
1075084067_1075084078 16 Left 1075084067 10:119402390-119402412 CCTTCTACCCTCCAGTTCTACAG 0: 1
1: 1
2: 3
3: 25
4: 228
Right 1075084078 10:119402429-119402451 GTGACAGGTATTCAGGAGAGGGG No data
1075084067_1075084080 20 Left 1075084067 10:119402390-119402412 CCTTCTACCCTCCAGTTCTACAG 0: 1
1: 1
2: 3
3: 25
4: 228
Right 1075084080 10:119402433-119402455 CAGGTATTCAGGAGAGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075084067 Original CRISPR CTGTAGAACTGGAGGGTAGA AGG (reversed) Intronic
901213652 1:7540993-7541015 CTGGAGAACTGGAGGTTGCAGGG + Intronic
901563305 1:10090511-10090533 CTGTAAAAGAGGAGGGAAGATGG + Intronic
903580660 1:24368156-24368178 CCCTAGACCTGGAGGGCAGAAGG + Intronic
903731481 1:25499260-25499282 CTGTAAAACTGGTGGGTAGCTGG + Exonic
905688256 1:39924504-39924526 TTGCATAACTGGAGGTTAGAGGG + Intergenic
906288887 1:44606445-44606467 TGGATGAACTGGAGGGTAGATGG + Intronic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
908183412 1:61628475-61628497 CCTTAAAACTGGGGGGTAGAAGG + Intergenic
908796840 1:67838546-67838568 CTGTATATCTGGAGGCTAGATGG - Intergenic
910276573 1:85455637-85455659 CTGAAGAAATGGAGAGTAAATGG - Intronic
910396964 1:86803259-86803281 CTTTAGGACAGGAGGATAGATGG - Intergenic
911477704 1:98393830-98393852 GTGTAGAAAGGGAGGGAAGAAGG + Intergenic
912565456 1:110584403-110584425 CTGTAGAACTGGAAAGAACATGG + Intergenic
912856349 1:113171566-113171588 CTGCAGACCTGGAGACTAGATGG + Intergenic
913518504 1:119624316-119624338 CTGAAGAACTGGTGGGCAGAGGG - Intronic
914810993 1:151028010-151028032 CTGTAGAACAGGAGTGGAGCTGG - Intronic
916211169 1:162361007-162361029 GTGTAGAGCTGGAGGGTGCAGGG + Intronic
919765497 1:201124678-201124700 CTGCAGGGCTGGAGGGGAGACGG + Intronic
919874082 1:201848732-201848754 CAATAGAGCTGGAGGGTAGATGG - Intronic
921516057 1:216093569-216093591 CTGTAGGATAGGAGGGTAAAGGG - Intronic
923128057 1:231049476-231049498 CTGTAGTACTAAAGGGTATATGG - Intergenic
923196198 1:231670206-231670228 TTGAAGAATTGGAGGGTTGAAGG + Intronic
923472268 1:234302468-234302490 ATGGAGAACTTGAGCGTAGATGG + Intronic
1064514833 10:16135749-16135771 GAGTAGAAATGGAGAGTAGAGGG + Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1068711726 10:60142176-60142198 CTGTATAACAGGAGGGAAGGTGG - Intronic
1069755283 10:70771056-70771078 CTAGAGAACTGAAGGGCAGATGG - Intergenic
1070665524 10:78340205-78340227 AAGTAGAACTGGTGGGTTGAAGG + Intergenic
1071191471 10:83106632-83106654 CTATAGAACTGGAAGCTAGAAGG + Intergenic
1071703447 10:87968476-87968498 CTTTTGAACTGGCAGGTAGAAGG - Exonic
1074938641 10:118212921-118212943 CTGTAAAACTGGAGGTTGTAAGG - Intergenic
1075084067 10:119402390-119402412 CTGTAGAACTGGAGGGTAGAAGG - Intronic
1075532032 10:123237784-123237806 CTGTAGAACTGGATGCTTGCTGG + Intergenic
1075691366 10:124397008-124397030 CTGTTGAACTACAGGGTATATGG - Intergenic
1076027774 10:127130443-127130465 CAGTTAAACTGGAGGGAAGAGGG + Intronic
1078907880 11:15704372-15704394 CTGGAAAACTGGAGGGTGGGAGG - Intergenic
1081124118 11:39301809-39301831 CTGTAGAACTGGAGAGGCAAAGG + Intergenic
1081525986 11:43928147-43928169 ATGTTGAGCTGGAGGGGAGACGG + Intronic
1084256588 11:67947035-67947057 GTGCAGATCTGGAGGGTGGAAGG - Intergenic
1084718657 11:70890073-70890095 TTTTAGATCTGGGGGGTAGAAGG + Intronic
1087063756 11:94008775-94008797 CTCTAGAACTGGTTGGTTGAAGG - Intergenic
1087933449 11:104004184-104004206 CTGTAGAAGGGGTGGGGAGAGGG + Intronic
1088840833 11:113626411-113626433 CTCTAGTTCTGGAGGCTAGAAGG + Intergenic
1088930567 11:114347268-114347290 CTGCTGAACTGCGGGGTAGAAGG + Intergenic
1089080407 11:115771927-115771949 CTGTAAAACTTCAGGCTAGAAGG + Intergenic
1090964407 11:131585440-131585462 CTGCAGGAAAGGAGGGTAGAGGG + Intronic
1091216365 11:133904802-133904824 TTGGAGAACTGGAGGGTGGAGGG - Intergenic
1092088585 12:5785833-5785855 CTGCTGGCCTGGAGGGTAGATGG - Intronic
1092149280 12:6236086-6236108 CGGGAGAACTGGTGGGCAGAGGG - Intronic
1092818348 12:12330563-12330585 CTGAAGCATTGGTGGGTAGAAGG + Exonic
1093023105 12:14221018-14221040 CTGCTGAACTGGGGGGTAGAAGG - Intergenic
1095042911 12:37464067-37464089 CTGTAGAACTGTAGGTTATCTGG + Intergenic
1096198934 12:49667188-49667210 CTGAAGAGCTGGTGGGTGGAGGG + Intronic
1096609547 12:52791817-52791839 CTGCAGAACAGAAGGGAAGATGG + Intronic
1096624920 12:52888845-52888867 AAGTAGAAGTGGAGGGTACAGGG - Intergenic
1099797796 12:87421012-87421034 CTTCAGAACTGGCAGGTAGAAGG + Intergenic
1100557602 12:95711603-95711625 CTGTTGAACTGGTGAGTAGAAGG + Intronic
1100980146 12:100157124-100157146 CTGTAGGGGTGGAGGGTGGAGGG - Intergenic
1101242017 12:102848351-102848373 CTGAAGAGGTGGAGGGTAGACGG + Intronic
1101507008 12:105356237-105356259 CTGGAGAATTGTAGTGTAGATGG + Intronic
1101661092 12:106766264-106766286 GTTTAGAACTTGAGGGTGGAAGG - Intronic
1102599207 12:114016239-114016261 CAGGAGAACAGGAGGGAAGAGGG + Intergenic
1102684326 12:114712790-114712812 ATGTAGAACTGGAAGGTATAGGG + Intergenic
1103243965 12:119439348-119439370 CCCTAGACCTGGAGGGGAGAAGG + Intronic
1105515774 13:21089635-21089657 TTGTAGAAGTGGAGGGTAGAGGG + Intergenic
1106756193 13:32825351-32825373 CTGTAGATCTGGAAGGCTGATGG - Intergenic
1110136265 13:72071048-72071070 CAGAAGAGCTGGAGGATAGAAGG - Intergenic
1112501136 13:99944176-99944198 CTGCAGAACTGAAGTGGAGATGG - Intergenic
1113239660 13:108322725-108322747 CTGTAGAGAGGGAGGTTAGAGGG + Intergenic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1115317002 14:32035433-32035455 GTACAGAACTGGAGGGTGGAGGG + Intergenic
1116344024 14:43766330-43766352 TTATAGAAGTGGAGAGTAGATGG - Intergenic
1116633959 14:47369535-47369557 CTGGAGGACTGCAGGGTGGAGGG - Intronic
1117089008 14:52230906-52230928 CTGCAGAACTTTAGGATAGAAGG - Intergenic
1117202252 14:53403279-53403301 CTGGAGAAATGGAGGTGAGATGG - Intergenic
1117287171 14:54297438-54297460 ATGTAGAAATTGAGGGTGGAGGG - Intergenic
1118303534 14:64635886-64635908 CTATGGAAGTGGAGGGGAGATGG - Intergenic
1121005206 14:90486121-90486143 GTGAAGAACTAGAGGGGAGAGGG + Intergenic
1123508540 15:20971581-20971603 CTCTAAAACTGGAGAGGAGAGGG - Intergenic
1123565762 15:21545330-21545352 CTCTAAAACTGGAGAGGAGAGGG - Intergenic
1125637979 15:41205259-41205281 CATTGGAACAGGAGGGTAGAGGG + Intronic
1128058777 15:64720145-64720167 CTGTGCCACTGGAAGGTAGAAGG - Intergenic
1128565335 15:68697342-68697364 CTGTATGACAGGTGGGTAGATGG + Intronic
1129556222 15:76512587-76512609 CTGCAGAAGTGGAGGGGAAAAGG + Intronic
1129908558 15:79207232-79207254 CTGTAGACATTGAGGGGAGAGGG - Intergenic
1130818126 15:87462654-87462676 CTGGATAATTGGAGGGTATATGG + Intergenic
1132212784 15:100036771-100036793 CGGTAGAGATGGAAGGTAGATGG - Intronic
1132772281 16:1570474-1570496 CTGAGCAAATGGAGGGTAGATGG - Intronic
1134047829 16:11114344-11114366 CTGTAGAATTGGAGATTCGATGG + Intronic
1137552352 16:49447107-49447129 CTGTAGTACTGGAGTAAAGACGG - Intergenic
1139190667 16:64859161-64859183 CTGTAAAACTGTGGGGTAGTAGG + Intergenic
1140048539 16:71459066-71459088 CTGTAGAACTGGACTGAGGATGG - Intronic
1140061609 16:71575376-71575398 CTGTCAAACTGAAGGATAGAAGG - Intronic
1141400285 16:83741348-83741370 CTGTAAAACTGTAGGAAAGAAGG - Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1143032259 17:3974297-3974319 CTGTAGAGATGGAGGCAAGAGGG - Intergenic
1143322595 17:6077818-6077840 CTGTATAACTGAAGGGAAGAGGG - Intronic
1143580770 17:7824386-7824408 CTGTAGAAGTGGGAGGTACAGGG - Intronic
1146427531 17:32756300-32756322 CTTTTGAACTGGCAGGTAGAAGG - Intronic
1147456068 17:40538901-40538923 CTCTAGACCTGGAAGGTAGTGGG + Intergenic
1148140298 17:45323342-45323364 CGATAGATGTGGAGGGTAGAAGG - Intergenic
1152448764 17:80363244-80363266 GTGGAGAACCTGAGGGTAGATGG - Exonic
1153222481 18:2873945-2873967 TTGGAGAACTTGAGGGTATAAGG - Intronic
1153516343 18:5905781-5905803 TTGTAGGACAGGAGGGAAGATGG - Intergenic
1153807041 18:8717724-8717746 CTGTAGAATGGGAGGGGAGGGGG + Intronic
1156557221 18:38081246-38081268 CTGTAAAACTGTAGTATAGAAGG + Intergenic
1157298890 18:46465581-46465603 CTTATGAACTGGAGGGAAGATGG - Intergenic
1157323734 18:46654442-46654464 TTCCAGAACTGGAGAGTAGAAGG - Intronic
1157486469 18:48090795-48090817 CAGTGGAACTGGAAGGTAGATGG - Intronic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1158818605 18:61132359-61132381 CAGTAGAGCTGGAAGCTAGATGG - Intergenic
1160753250 19:745196-745218 CTGGGGAACTGGAGGTTACAGGG - Intronic
1161012562 19:1967697-1967719 CTGCAGAACTGAAGGGTGGTGGG - Intronic
1161012584 19:1967758-1967780 CTGCAGAACTGAAGGGTGGTCGG - Intronic
1161012605 19:1967819-1967841 CTGCAGAACTGAAGGGTGGTCGG - Intronic
1161012626 19:1967880-1967902 CTGCAGAACTGAAGGGTGGTCGG - Intronic
1161012647 19:1967941-1967963 CTGCAGAACTGAAGGGTGGTCGG - Intronic
1161012666 19:1967995-1968017 CTGCAGAACTGAAGGGTGGTCGG - Intronic
1161012685 19:1968049-1968071 CTGCAGAACTGAAGGGTGGTGGG - Intronic
1161012708 19:1968110-1968132 CTGCAGAACTGAAGGGTGGTCGG - Intronic
1161012762 19:1968272-1968294 CTGCAGAACTGAAGGGTGGTCGG - Intronic
1163832693 19:19554600-19554622 TGGGAGAGCTGGAGGGTAGACGG - Intergenic
1165473247 19:36015255-36015277 CTGTAGGACTTGAGGGCACAGGG + Exonic
1165891911 19:39117728-39117750 CTGAAGATCTGGAGGGAGGAAGG - Intergenic
1166305138 19:41933043-41933065 CTGCAGAATTGGTGGGCAGATGG + Intergenic
925073225 2:987747-987769 CTGGAGGACAGGAGGGTTGATGG + Intronic
926027934 2:9560889-9560911 CTGTGGAACTGGAGGGTAATTGG - Intergenic
926081802 2:9993223-9993245 CTGAAGAATTGGAGGGTGAAGGG + Exonic
927002419 2:18811943-18811965 TTGGAGAAGTGGAGGGGAGAGGG + Intergenic
927639222 2:24836280-24836302 CCGTAGAACAAGAGGGTAGATGG - Intronic
928476298 2:31630876-31630898 CTTCAGAACAGAAGGGTAGATGG + Intergenic
928771512 2:34707435-34707457 CTGTAGAAGAGAAGGGCAGAAGG + Intergenic
929795978 2:45058654-45058676 CTGAAGAATTCCAGGGTAGACGG - Intergenic
930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG + Intronic
931322602 2:61185768-61185790 CTGAATAATTGGAGGGGAGATGG + Intronic
931889384 2:66654115-66654137 CTGTGGAAATAGAAGGTAGATGG + Intergenic
932158628 2:69440284-69440306 CTGTTGAACTATAGGGTATATGG - Intergenic
934922387 2:98356084-98356106 CTTGAGAACTGCAGGGTAGAAGG - Intronic
935009787 2:99123086-99123108 CTGAAAAACTGGAGGTAAGAAGG - Intronic
935268584 2:101414740-101414762 CTGTCCATCTGGAGGGCAGAGGG - Intronic
937111696 2:119371562-119371584 CTGAAGCACTGGAGAGTACATGG - Intronic
938408710 2:131046625-131046647 TTGGAGAACTAGAGGGCAGAGGG - Exonic
939126243 2:138180874-138180896 ATGCAGAAGTGGAGGGTAGGGGG + Intergenic
940701738 2:157053215-157053237 CTGAAGAGCTGGAGAGAAGAGGG + Intergenic
945022061 2:205583830-205583852 CAGTAGAACTGGAGGTGAGGTGG - Intronic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
946606786 2:221413832-221413854 CTGTAGTACTGGCGGGGATAGGG - Intergenic
946999236 2:225434235-225434257 CTGCTGTACTGGAGGGCAGAGGG - Intronic
947367099 2:229407779-229407801 TTGAAGAACTGCAGGGGAGAGGG + Intronic
947539728 2:230967916-230967938 GTGTAGAACTGTAGGGTCAAAGG - Intergenic
948597371 2:239088579-239088601 CTGAAGCACCGGAGGGTAGACGG + Intronic
1169783603 20:9334801-9334823 CTGTAGAGCTAGGGGCTAGAAGG + Intronic
1172629015 20:36365965-36365987 CTGTAAAATTGGAGGGGAGAGGG + Intronic
1172754912 20:37276760-37276782 CTCTGGAAATGGATGGTAGACGG + Intergenic
1172940428 20:38650170-38650192 CTGGAGGGCTGGAGGGTGGAGGG - Exonic
1173762108 20:45571666-45571688 TTGTAGAAGTAGAGAGTAGATGG - Intronic
1173801809 20:45898832-45898854 CTGTGGCACTGGGGGTTAGAGGG + Exonic
1174148992 20:48472880-48472902 CTGGAGACCTGGAGAGGAGATGG - Intergenic
1174149300 20:48474902-48474924 CTGGAGAACTGGAGAGGAGATGG - Intergenic
1175101216 20:56580112-56580134 CTGTAGAAATGGAGGAGGGAAGG + Intergenic
1176032725 20:63021504-63021526 CTGTAGGACAGGAGGGAAGGAGG - Intergenic
1177428445 21:20957304-20957326 CTGTTGAACTGGGCTGTAGAAGG + Intergenic
1180616779 22:17133606-17133628 CTGCAGAACTGGAGGTCAGAAGG + Intergenic
1180700722 22:17780246-17780268 CTGTGCATCTGGAGGGCAGAGGG + Intergenic
1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG + Intergenic
1181163729 22:20972694-20972716 CAGGAGAACTGCAGGGTCGAAGG + Intronic
1182040845 22:27237863-27237885 ATGTAGAATTTGAGGGGAGAGGG + Intergenic
1184631829 22:45787478-45787500 CTTGGGAACTGGAGGCTAGAAGG - Intronic
1185373092 22:50469866-50469888 CTGTAACCCTGGAGGGCAGATGG - Intronic
949611352 3:5706953-5706975 CTTCAGGACTGGAGGATAGATGG - Intergenic
951615584 3:24539996-24540018 CTGAAGAAAAGGAGGGAAGAGGG - Intergenic
953023916 3:39134043-39134065 CTGGAGAACTGCATGGGAGAAGG + Intronic
953383235 3:42489957-42489979 CTGAAGAAATGGAGGGTCGGAGG - Intronic
953403184 3:42644784-42644806 GTGGAGATCTGCAGGGTAGATGG - Intronic
955855895 3:63273138-63273160 CTGTAGAACTGAAGTAAAGATGG - Intronic
956601432 3:71026823-71026845 CTGTAGTACTGGAGGCTGGTTGG + Intronic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
962409934 3:135132309-135132331 GTGTAGAACTCAAGGGTAGAAGG - Intronic
962472406 3:135723179-135723201 CAGTAGAGCTGGAGTGAAGATGG + Intergenic
964147996 3:153489354-153489376 TTGTAGAGGTGGAGGGAAGAAGG - Intronic
965269626 3:166597483-166597505 AAGTAGAACTGGAGGCTACAAGG - Intergenic
965774249 3:172211594-172211616 CTGTAGAAGAGGAGGGCTGATGG + Intronic
965826127 3:172731985-172732007 CTGTACAACTGGAGTGCACAAGG - Intergenic
966469523 3:180273456-180273478 TAGTAGCTCTGGAGGGTAGAAGG - Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
969512941 4:7629987-7630009 TAGGAGAACTGGAGGGGAGAGGG - Intronic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
975275144 4:72488965-72488987 TTATAGAAATGGAGAGTAGAAGG - Intronic
979940295 4:126753671-126753693 CTGAAGTACTGGAGGTTAGGAGG - Intergenic
980576315 4:134687520-134687542 CTGATGCACTGGAGGGTCGAAGG + Intergenic
981207519 4:142060828-142060850 CTGTACAACTGGAAGGAAAAAGG + Intronic
982460201 4:155660448-155660470 TTGTAGAAAAGGAGGGAAGAAGG - Intergenic
984381509 4:178998240-178998262 CTCTAAAAGTGGAGGGAAGATGG - Intergenic
984604672 4:181771284-181771306 TTGTACAAATGGAGGGTATAAGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
990287530 5:54314656-54314678 CTTTGGAGCTGGGGGGTAGAAGG - Intergenic
990597235 5:57323924-57323946 CTGGAGTTCTGGAGGTTAGAAGG - Intergenic
991141995 5:63255217-63255239 GTTTAGAACTGTAGGGTAGAAGG - Intergenic
996841197 5:127849292-127849314 CTGTAGAACTGGGGAGAATAAGG - Intergenic
999313707 5:150570364-150570386 TTAGAGAACTGGAGGGTGGAGGG - Intergenic
999322042 5:150621496-150621518 CTGGAGATCAGGAGGGAAGAAGG + Intronic
999585834 5:153088640-153088662 GTGTGGAAATGAAGGGTAGATGG + Intergenic
1000364220 5:160476283-160476305 CCGAAGAACTGGAGGTTTGAGGG + Intergenic
1000533535 5:162453231-162453253 CTGGAGATCTGGAGGGCAGAGGG - Intergenic
1001946584 5:175783864-175783886 CCTGAGAACTGGAGGGCAGAAGG + Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1005375733 6:25180469-25180491 CTCTAGAGCTGGAGGTGAGAAGG - Intergenic
1005814795 6:29541768-29541790 GTGCAGAAATGGAAGGTAGATGG - Intergenic
1006763959 6:36488413-36488435 ATGGAGAACAGGAGGGAAGATGG - Exonic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1008904482 6:56661438-56661460 CTGTAAAGCTTGAGGGAAGATGG - Intronic
1011764560 6:90606188-90606210 CAGAATAACTTGAGGGTAGATGG - Intergenic
1013464563 6:110406474-110406496 CTGTAGAAACAGAGAGTAGATGG - Intronic
1014203686 6:118631755-118631777 CTATAGAAATGGAGAGTAAATGG + Intronic
1015792687 6:136979958-136979980 TCGTAGAACTAGAGGGTTGAGGG - Intergenic
1016838492 6:148503276-148503298 CTGTAGAATTGACGGGTAAAAGG - Intronic
1017588569 6:155953692-155953714 CTGTGGAAGTGGAGGGGAGCTGG + Intergenic
1019033997 6:169039493-169039515 CTGGAGACTTGGAGGGTGGAAGG + Intergenic
1020141160 7:5612699-5612721 CAGCAGAACTGGTGGGTTGAGGG + Intergenic
1022461155 7:30608525-30608547 CTGTAGAAATAGAGTCTAGAAGG + Intronic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1025036533 7:55596553-55596575 GTATAGAACTGGAAAGTAGAAGG - Intergenic
1029493615 7:100885405-100885427 ATGGAGAAGTGGAGGGTAGAGGG + Intronic
1030065261 7:105654500-105654522 CTGTAGCACTGGAAGCCAGAAGG + Intronic
1031498961 7:122488047-122488069 CTGTAGAACTGTAGCTTATAGGG + Intronic
1032510130 7:132465819-132465841 CTGCAGAGCTGGAGGAGAGAGGG + Intronic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037517998 8:19652938-19652960 CTGGAAAATTTGAGGGTAGAGGG - Intronic
1038090806 8:24250834-24250856 CTGGAGTACAGGAGGGTATATGG - Intergenic
1041419282 8:57648359-57648381 CTCTAGAAATGGAGGGTGGGTGG - Intergenic
1042042223 8:64604712-64604734 ATGTAGGACTGGAGGAAAGATGG + Exonic
1042723755 8:71850336-71850358 CTTTAGAATTGGAGGTCAGAGGG - Intronic
1042741150 8:72048346-72048368 CTGTAGAACTTGAGGGTAGAGGG + Intronic
1042756802 8:72223159-72223181 CTGCAGAACTTGAGGGTAGATGG + Intergenic
1043613384 8:82093539-82093561 CTTTAGGACAGGAGGATAGATGG - Intergenic
1050980598 9:12008863-12008885 CTGTAGAACTGCAAGGTGGAAGG + Intergenic
1052590696 9:30490173-30490195 CTGTACTACTGGAGTGGAGAGGG - Intergenic
1052642437 9:31186177-31186199 ATGAAGAAGTGAAGGGTAGAGGG - Intergenic
1053418825 9:37964000-37964022 CTCTTGAACTAGAGGGAAGAAGG - Intronic
1057479207 9:95430971-95430993 TTGGAGAATTGGAGGATAGAAGG + Intergenic
1062340971 9:136093924-136093946 CTGGAGAACAGGAGGGAAGGAGG + Intronic
1062480314 9:136747998-136748020 CTGCAGAACTGGAGGCTGGAGGG - Intronic
1062480324 9:136748036-136748058 CTGTAGAACTGGAGGCTGGAGGG - Intronic
1062480345 9:136748119-136748141 TTGGAGAACTGGAGGCTGGAGGG - Intronic
1186924816 X:14321971-14321993 CAGTTGACCTGGAGGGGAGAAGG - Intergenic
1187433577 X:19246943-19246965 CTGTAGCCCTGGAGTGAAGAGGG - Intergenic
1187542779 X:20214466-20214488 CAGCAGAACTGGATGCTAGAAGG - Intronic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1199372134 X:147062237-147062259 TTATAGAAGTAGAGGGTAGAGGG + Intergenic
1199487388 X:148362841-148362863 CTGTAGATGTGGTGGGTGGAGGG + Intergenic
1199687546 X:150277828-150277850 TTGTAAAACTGGAGAGCAGAAGG + Intergenic
1201723896 Y:17133509-17133531 CTGCTGAACTGGGGGGTAGTAGG + Intergenic
1202270176 Y:23063980-23064002 CTGTAAAACTGAATGCTAGATGG + Intergenic
1202295851 Y:23356702-23356724 CTGTAAAACTGAATGCTAGATGG - Intergenic
1202423170 Y:24697725-24697747 CTGTAAAACTGAATGCTAGATGG + Intergenic
1202447619 Y:24972361-24972383 CTGTAAAACTGAATGCTAGATGG - Intergenic