ID: 1075085892

View in Genome Browser
Species Human (GRCh38)
Location 10:119414061-119414083
Sequence GGGCAGCCCCCTTGTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075085888_1075085892 -5 Left 1075085888 10:119414043-119414065 CCCCATGACAGCAGAACAGGGCA 0: 1
1: 0
2: 1
3: 22
4: 173
Right 1075085892 10:119414061-119414083 GGGCAGCCCCCTTGTGTGGAAGG No data
1075085889_1075085892 -6 Left 1075085889 10:119414044-119414066 CCCATGACAGCAGAACAGGGCAG 0: 1
1: 0
2: 0
3: 21
4: 198
Right 1075085892 10:119414061-119414083 GGGCAGCCCCCTTGTGTGGAAGG No data
1075085882_1075085892 13 Left 1075085882 10:119414025-119414047 CCCAAGAAATGACCTCCACCCCA 0: 1
1: 0
2: 0
3: 8
4: 181
Right 1075085892 10:119414061-119414083 GGGCAGCCCCCTTGTGTGGAAGG No data
1075085884_1075085892 1 Left 1075085884 10:119414037-119414059 CCTCCACCCCATGACAGCAGAAC 0: 1
1: 0
2: 1
3: 35
4: 254
Right 1075085892 10:119414061-119414083 GGGCAGCCCCCTTGTGTGGAAGG No data
1075085885_1075085892 -2 Left 1075085885 10:119414040-119414062 CCACCCCATGACAGCAGAACAGG 0: 1
1: 0
2: 2
3: 21
4: 172
Right 1075085892 10:119414061-119414083 GGGCAGCCCCCTTGTGTGGAAGG No data
1075085883_1075085892 12 Left 1075085883 10:119414026-119414048 CCAAGAAATGACCTCCACCCCAT 0: 1
1: 0
2: 1
3: 16
4: 188
Right 1075085892 10:119414061-119414083 GGGCAGCCCCCTTGTGTGGAAGG No data
1075085890_1075085892 -7 Left 1075085890 10:119414045-119414067 CCATGACAGCAGAACAGGGCAGC 0: 1
1: 0
2: 1
3: 23
4: 205
Right 1075085892 10:119414061-119414083 GGGCAGCCCCCTTGTGTGGAAGG No data
1075085881_1075085892 16 Left 1075085881 10:119414022-119414044 CCTCCCAAGAAATGACCTCCACC 0: 1
1: 0
2: 1
3: 3
4: 141
Right 1075085892 10:119414061-119414083 GGGCAGCCCCCTTGTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075085892 Original CRISPR GGGCAGCCCCCTTGTGTGGA AGG Intronic
No off target data available for this crispr