ID: 1075086149

View in Genome Browser
Species Human (GRCh38)
Location 10:119415688-119415710
Sequence TGGCCCCAGTCAAAACCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 138}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075086149_1075086161 26 Left 1075086149 10:119415688-119415710 CCAGCTGGTTTTGACTGGGGCCA 0: 1
1: 0
2: 0
3: 16
4: 138
Right 1075086161 10:119415737-119415759 GAGGGCTGGCTCAGGATACCTGG No data
1075086149_1075086159 18 Left 1075086149 10:119415688-119415710 CCAGCTGGTTTTGACTGGGGCCA 0: 1
1: 0
2: 0
3: 16
4: 138
Right 1075086159 10:119415729-119415751 CCTTCCTAGAGGGCTGGCTCAGG No data
1075086149_1075086154 7 Left 1075086149 10:119415688-119415710 CCAGCTGGTTTTGACTGGGGCCA 0: 1
1: 0
2: 0
3: 16
4: 138
Right 1075086154 10:119415718-119415740 CAAAGCCATGTCCTTCCTAGAGG No data
1075086149_1075086157 12 Left 1075086149 10:119415688-119415710 CCAGCTGGTTTTGACTGGGGCCA 0: 1
1: 0
2: 0
3: 16
4: 138
Right 1075086157 10:119415723-119415745 CCATGTCCTTCCTAGAGGGCTGG No data
1075086149_1075086155 8 Left 1075086149 10:119415688-119415710 CCAGCTGGTTTTGACTGGGGCCA 0: 1
1: 0
2: 0
3: 16
4: 138
Right 1075086155 10:119415719-119415741 AAAGCCATGTCCTTCCTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075086149 Original CRISPR TGGCCCCAGTCAAAACCAGC TGG (reversed) Intronic
902862169 1:19254250-19254272 TGGTCCCAGCCAAAATTAGCAGG + Intronic
903587962 1:24431466-24431488 TGGCCCCAGTCCAAAGAAGATGG + Intronic
904094745 1:27967826-27967848 TGGCCCCAGTCAGAACCTCTGGG + Exonic
905514946 1:38555820-38555842 TAGCCGCAGCCACAACCAGCAGG + Intergenic
912692103 1:111812276-111812298 AGGCCACAGGCAAAATCAGCTGG - Intronic
917638347 1:176958501-176958523 TGCCCCCAGTCATGACCACCTGG - Intronic
920034172 1:203055378-203055400 TAGCCCCAGCCAGGACCAGCAGG - Intronic
921167046 1:212514902-212514924 CGGCCCCAGCCAGAAACAGCCGG + Intergenic
921619796 1:217312926-217312948 GGGCCCCACTCAAAACTAGCAGG - Intergenic
922036044 1:221849333-221849355 AGGCCCCAAACCAAACCAGCTGG - Intergenic
922632556 1:227131291-227131313 TGGGCCCAGTCAAAACTGGCTGG + Intronic
922786808 1:228286945-228286967 TGGCCCCAGTGATGAGCAGCTGG - Exonic
923715975 1:236425108-236425130 GGGCCACAGACAAAACCACCTGG - Intronic
924158993 1:241210600-241210622 TGGCCACACTCCAAAGCAGCAGG - Intronic
1063870881 10:10416559-10416581 TGGCATCAGCCCAAACCAGCTGG - Intergenic
1064282245 10:13961384-13961406 TGGCCCTTTTGAAAACCAGCTGG - Intronic
1064656076 10:17557585-17557607 TGAGCCCAGGCAAAACCAGTGGG - Intergenic
1065956517 10:30698039-30698061 TGGCACATGTCAAAACCAGAGGG - Intergenic
1074109634 10:110413501-110413523 TGAGCCCAGCCAAAACCATCTGG - Intergenic
1074147690 10:110730962-110730984 TGGCCCCATTAGAAACCAGTGGG + Intronic
1075086149 10:119415688-119415710 TGGCCCCAGTCAAAACCAGCTGG - Intronic
1083632734 11:64104135-64104157 TGACCCCAGTCAAACCCAGAGGG + Exonic
1084801556 11:71547521-71547543 AGGCCACGGTCAAATCCAGCTGG + Intronic
1087706787 11:101502416-101502438 TGTCCCCAGTAAAAAAGAGCAGG + Intronic
1090395554 11:126415865-126415887 TGGCCTCAGTCCAGGCCAGCTGG - Intronic
1091387892 12:106360-106382 TGTCCCCAGCCACAGCCAGCGGG + Intronic
1092679322 12:10960363-10960385 TGGCCTCTGCCAAAACCAGATGG + Intronic
1092681138 12:10982345-10982367 TGGCCTCTGTCAAAACCAGATGG + Intronic
1092684476 12:11026674-11026696 TGGCCTCTATCAAAACCAGACGG + Intronic
1094390314 12:29942040-29942062 GGACCCCAGCCATAACCAGCAGG - Intergenic
1098765576 12:74484266-74484288 TGTCCTCAGTCAAAACTACCTGG + Intergenic
1099879528 12:88450885-88450907 TGGCCTCACTCAGAAACAGCTGG + Intergenic
1102051612 12:109866303-109866325 TGGCCCAGGTCAGAAACAGCAGG - Intronic
1102566475 12:113800589-113800611 CGTGCCCAGCCAAAACCAGCAGG - Intergenic
1103704374 12:122863349-122863371 TGGCTCAAGTCCAAGCCAGCCGG - Intergenic
1107716401 13:43203963-43203985 TGGCCCCAGCCAAGGCCATCTGG - Intergenic
1108532782 13:51343170-51343192 TCATCCCAGTGAAAACCAGCCGG + Intronic
1108741480 13:53343254-53343276 TGGCCCTATCCAGAACCAGCTGG - Intergenic
1109782887 13:67135858-67135880 TCCCCCCAGTCAACACCACCAGG - Intronic
1117878486 14:60281724-60281746 TGGGCCCATTCTAGACCAGCGGG + Intronic
1117906958 14:60600008-60600030 TTGCCCCATTCAGCACCAGCTGG + Intergenic
1118719747 14:68585626-68585648 TTCCCCAAGTCAAAATCAGCTGG + Intronic
1119546726 14:75477345-75477367 AGGCCCCACTCAAAACTGGCAGG - Intergenic
1121837912 14:97108422-97108444 AGGCCCCTGACAAAACCTGCAGG - Intergenic
1122446406 14:101772897-101772919 TGGCCCCATTCATAATCAGCAGG - Intronic
1124179763 15:27461605-27461627 TGGCCCCACTCATATCCTGCCGG + Intronic
1124231118 15:27947257-27947279 TGGCCCCTGTGAAACCCATCTGG + Intronic
1124711839 15:32019787-32019809 GGGCACCAGCCAAGACCAGCAGG + Intergenic
1125768672 15:42151183-42151205 TGGCCCAAGAGAAAACCAGTAGG + Intronic
1126192706 15:45895270-45895292 TGTCCTTATTCAAAACCAGCGGG + Intergenic
1126556159 15:49989715-49989737 AGGCCCCAGTCAAAACAAAATGG + Intronic
1127329823 15:57927780-57927802 TGGCCCCTGTCCAAGGCAGCAGG + Intergenic
1128835992 15:70809603-70809625 AGGCCACAGTGAAAACAAGCAGG - Intergenic
1129744568 15:78008808-78008830 CGGCCTCAGTCACAAACAGCAGG + Intronic
1131615128 15:94008143-94008165 CAGAGCCAGTCAAAACCAGCAGG - Intergenic
1137565457 16:49529978-49530000 TGCCCCTAGTCAACACCAGGCGG - Intronic
1140778426 16:78272177-78272199 TGACCCCAGTCAACACCACAAGG - Intronic
1144023026 17:11253840-11253862 TTGCCACAGTCATAACCAGCTGG + Intronic
1144812420 17:18008981-18009003 TGGCACCAGGCAGAGCCAGCTGG - Intronic
1146057465 17:29588663-29588685 TGTTCCCAGTCACCACCAGCAGG + Intronic
1146280829 17:31543242-31543264 AGGCCCCAGCCAAGACTAGCAGG + Intergenic
1148164011 17:45469592-45469614 TGGACCCAGTCCAAGCCATCAGG - Intronic
1148994077 17:51693133-51693155 TAAAACCAGTCAAAACCAGCTGG - Intronic
1150395243 17:64816246-64816268 TGGACCCAGTCCAAGCCATCAGG - Intergenic
1156480648 18:37434469-37434491 TGGCCCCTGTCTAAAACAGGGGG + Intronic
1157568443 18:48696356-48696378 TGACCCCAGTCAGCACCAACAGG - Intronic
1160098401 18:75897631-75897653 TAACGCCAGTGAAAACCAGCTGG + Intergenic
1160909595 19:1468568-1468590 CAGCCTCAGTCAAGACCAGCGGG + Exonic
1161873245 19:6886808-6886830 TGGCCCCAGAAAGCACCAGCTGG - Intergenic
1167471693 19:49679287-49679309 GAGCCCCAAACAAAACCAGCTGG - Intronic
1167866944 19:52336483-52336505 TGGCCCAAGGCAGAACGAGCGGG - Exonic
927114346 2:19886385-19886407 TGGCCCAAGGCAGAAACAGCGGG + Intergenic
929998140 2:46842281-46842303 TGACCCCAGGCAAGACCAGCAGG - Intronic
934913847 2:98282097-98282119 TGGCAAAATTCAAAACCAGCAGG + Intronic
936380910 2:111985177-111985199 TGACTCCAGTCAAACCCAGAGGG + Intronic
937750184 2:125467453-125467475 GGGCCCCATTCAAAACTAGCAGG + Intergenic
938063979 2:128271314-128271336 TGGCTCCAGACATGACCAGCAGG - Intronic
942041338 2:172066729-172066751 AGGCCCCACTCAAAATCAGCAGG - Intronic
943529930 2:189066492-189066514 TGGCCCCTGTTAAAAACAGAAGG + Exonic
944396953 2:199279362-199279384 AGGCCTCAATGAAAACCAGCTGG + Intronic
947206459 2:227665887-227665909 TGGCCCCAGTCAAGACCTTGTGG + Intergenic
947768072 2:232650036-232650058 TGGCCCGGGTCAGAAGCAGCAGG + Intronic
948886026 2:240885280-240885302 TGGCCCCAGTAGAAGCCAGATGG - Intergenic
1169412495 20:5383366-5383388 TGGCACCTGACAAAACCACCAGG + Intergenic
1170392380 20:15889720-15889742 TAGCCCCAGTCTGAGCCAGCAGG + Intronic
1173986176 20:47263244-47263266 TGGGCCCATTTAAAAACAGCTGG + Intronic
1175576614 20:60065295-60065317 TGGTCCCGGTCTAAAGCAGCTGG + Intronic
1175956304 20:62611284-62611306 TGCCCACAGCCAGAACCAGCTGG - Intergenic
1175978287 20:62724557-62724579 AGCCTCCAGTTAAAACCAGCGGG + Intronic
1176088215 20:63307563-63307585 TGGCCACAGTCACTTCCAGCAGG + Exonic
1176231049 20:64033108-64033130 GGGCCCCAGAGAAAACCAGCAGG - Intronic
1177713553 21:24811011-24811033 TGGTAGCTGTCAAAACCAGCAGG + Intergenic
1177854978 21:26390554-26390576 CTGCCACAGTCAAAACCAGCTGG - Intergenic
1178602224 21:34004555-34004577 TGGCCCCAAGCAGAAGCAGCAGG + Intergenic
1179175228 21:39003259-39003281 AAGCCCCAGTCCCAACCAGCTGG + Intergenic
1179962022 21:44772952-44772974 TGGCTCCAGCCAAAATGAGCTGG + Intronic
1180022439 21:45136776-45136798 TGGCCCCTGTGGACACCAGCTGG - Intronic
1182026712 22:27124785-27124807 TGGCAATAGTCAACACCAGCTGG + Intergenic
1183417606 22:37691477-37691499 TGACCCCAGGCAAAGGCAGCTGG - Exonic
1183671582 22:39276046-39276068 TGGCCCCAGGTAGAAGCAGCAGG + Intergenic
951421932 3:22496836-22496858 TGTTCCCAGTCAAGATCAGCAGG - Intergenic
953133733 3:40164961-40164983 TGGCCCCAGTGATAACCTGATGG - Intronic
953324750 3:42003525-42003547 TGGTCCCAGTCACAACTAGGTGG + Intergenic
957303886 3:78431261-78431283 TGTCACTAGACAAAACCAGCAGG - Intergenic
959063831 3:101638074-101638096 TGGGCCCAGACACTACCAGCAGG + Intergenic
960300963 3:116002167-116002189 TTGCCCTGGTCCAAACCAGCAGG + Intronic
962188038 3:133280736-133280758 TGAACCTAGTCAAAACCAGAAGG - Intronic
963987303 3:151611376-151611398 TGGCCTCAGGCAAAAGTAGCTGG - Intergenic
965589753 3:170351318-170351340 TGCCCCCAGTCACAGACAGCTGG - Intergenic
965766530 3:172136481-172136503 TGGCCCCAATCAACAACAGCTGG - Intronic
967805028 3:193708195-193708217 TGGCCCTAGTCATAATCTGCAGG + Intergenic
973853549 4:54986789-54986811 TGGCCACAGCCTAAACCAGTGGG - Intergenic
981234832 4:142403021-142403043 TGACACCAGTCAAAAACAGTGGG + Exonic
984719124 4:182953671-182953693 TAGCCCCTGTAAAAACCAGATGG + Intergenic
992943168 5:81783193-81783215 AGGGCCCAGTCAAAAGTAGCAGG - Intergenic
995604165 5:113833505-113833527 TGGCCCCACTCAACACCAGGGGG + Intergenic
997456983 5:134024982-134025004 TGGCCCCAGCCAACACCACATGG + Intergenic
997654787 5:135546738-135546760 AGGCCCCAGTTAACATCAGCGGG - Intergenic
999260170 5:150233438-150233460 TGGCTCCAGTCAGAATCACCTGG + Intronic
999340195 5:150763594-150763616 TGGCCCCATTCCAAACGGGCTGG - Intergenic
999705543 5:154269592-154269614 TGGCCCCAGCCACGTCCAGCTGG - Intronic
1005696285 6:28355506-28355528 AAGCCCCAGTCAAAACTATCTGG + Exonic
1006219161 6:32473428-32473450 TGTCCCCAGCCAAAGCCAGTGGG + Intergenic
1006225025 6:32530131-32530153 TGTCCCCAGCCAAAGCCAGTGGG + Exonic
1006231339 6:32589649-32589671 TGTCCCCAGACAAAGCCAGTGGG + Exonic
1010613488 6:77984946-77984968 TGGCCACAGTCTAAGCTAGCTGG - Intergenic
1013079493 6:106800174-106800196 TGGCCCCTCTCAAAATCACCTGG - Intergenic
1013749162 6:113382199-113382221 TGGCCACACTGAAAAGCAGCAGG + Intergenic
1015217353 6:130765629-130765651 TGGCCTCAGTCAGTACCACCAGG - Intergenic
1018450924 6:163906705-163906727 GTGCACCAGTCAATACCAGCAGG - Intergenic
1023041453 7:36176243-36176265 TCGCCCCAGCCACCACCAGCAGG - Intronic
1023155866 7:37251461-37251483 TGGCCCCACCCAGTACCAGCTGG + Intronic
1024467163 7:49723448-49723470 GGGCCCCACACAAAACTAGCAGG + Intergenic
1029227015 7:99035551-99035573 TGGACCCAGTCACAAACTGCAGG + Exonic
1031439997 7:121782373-121782395 TGGAGCCAGTCATGACCAGCTGG + Intergenic
1031578112 7:123440144-123440166 TGCCCTCAGACAACACCAGCTGG + Intergenic
1038477364 8:27877668-27877690 TTTCCTTAGTCAAAACCAGCTGG + Intronic
1043149370 8:76694563-76694585 CTGCCCCAGTGCAAACCAGCCGG - Intronic
1044927390 8:97221211-97221233 TGGTCCCTGTCCAATCCAGCTGG - Intergenic
1049454549 8:142680418-142680440 TGCCCACAGTCAACACCAGCGGG - Intronic
1051352531 9:16212074-16212096 AGGTCCCAGTCAAAAGCTGCAGG + Intronic
1055223459 9:73966168-73966190 GAGCCCCACTCAAAACTAGCAGG - Intergenic
1057004971 9:91549055-91549077 TGGCTCCATTCAAAACTAGCAGG + Intergenic
1057809658 9:98248082-98248104 TGGCCAAAGTCAAAGCTAGCAGG + Intronic
1058719779 9:107753102-107753124 TGACCCCTGTCAAAACCACATGG + Intergenic
1062131078 9:134893494-134893516 TGGCCCCAGTCAGATGCAACAGG + Intergenic
1062438039 9:136555531-136555553 TGGCCCCAGACACAGCCAACAGG - Intergenic
1062580159 9:137225846-137225868 TGCCCCCATCCAGAACCAGCAGG + Exonic
1188078255 X:25805894-25805916 TGCCTCCAATCAAACCCAGCAGG + Intergenic
1191832755 X:65432562-65432584 GGGCCCCACTCAGAACTAGCAGG + Intronic
1191986400 X:66985751-66985773 TGACCCCAGTCAGAACCATGAGG - Intergenic
1195737964 X:108033088-108033110 TGGTCCCAGCCCCAACCAGCAGG - Intergenic
1196114507 X:111984336-111984358 GGGCCCCACTCAAAACTAGCAGG + Intronic
1198494628 X:137179279-137179301 TGGGCCCAGTCAACAACAACAGG + Intergenic
1201584078 Y:15541783-15541805 TGGCCTCATTCAATACCAGTGGG + Intergenic