ID: 1075086922

View in Genome Browser
Species Human (GRCh38)
Location 10:119419837-119419859
Sequence CCCACGGCTCAGAGAAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 327}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075086922_1075086930 17 Left 1075086922 10:119419837-119419859 CCCTCCCTTCTCTGAGCCGTGGG 0: 1
1: 0
2: 2
3: 34
4: 327
Right 1075086930 10:119419877-119419899 GCATCACTTGCCTCTGCTATGGG No data
1075086922_1075086929 16 Left 1075086922 10:119419837-119419859 CCCTCCCTTCTCTGAGCCGTGGG 0: 1
1: 0
2: 2
3: 34
4: 327
Right 1075086929 10:119419876-119419898 TGCATCACTTGCCTCTGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075086922 Original CRISPR CCCACGGCTCAGAGAAGGGA GGG (reversed) Intronic
900086777 1:902352-902374 CCCTCGTCTCAGAGGAAGGACGG + Intergenic
900367099 1:2315749-2315771 CCCACAGCTCAGAGCATGGGTGG - Intergenic
900661868 1:3788718-3788740 GGCACGGCTCAGACATGGGAGGG + Intronic
900773298 1:4562881-4562903 CCCATCCCTCAGGGAAGGGAGGG - Intergenic
901220616 1:7581576-7581598 TCCACGGCCCAGTGGAGGGAGGG - Intronic
901311297 1:8271313-8271335 CTTACGGCTGAGTGAAGGGAAGG - Intergenic
901712902 1:11129720-11129742 CTCAGGTATCAGAGAAGGGAAGG - Exonic
901810005 1:11762139-11762161 CCCACGGCTCAGGGCTGGGCGGG + Exonic
902374559 1:16024206-16024228 CCCAAGGCACGGAGGAGGGAAGG - Intronic
902817194 1:18923035-18923057 CACACGGCTCAGAGCGGGGAAGG + Intronic
903213032 1:21829205-21829227 CCCATGGCTCAGAGAGGGCTAGG + Intronic
903668863 1:25023870-25023892 CCCAAGGCTCAGAGATGGGCTGG + Intergenic
903970389 1:27115051-27115073 ACTAAGGCTCAGAAAAGGGAAGG + Intronic
904298950 1:29541862-29541884 CCCACGGGACACAGGAGGGAGGG - Intergenic
904444672 1:30559277-30559299 CACACCACTCAGATAAGGGATGG - Intergenic
904567267 1:31435257-31435279 ACCAGGGCCCAGAGAAGAGAAGG - Intergenic
905110140 1:35588780-35588802 GCCTGGGCACAGAGAAGGGATGG + Intronic
905174576 1:36127498-36127520 GGCACTGCCCAGAGAAGGGAGGG + Intergenic
906088430 1:43156550-43156572 CCCACCACTGAGAGAATGGAAGG + Intergenic
906251420 1:44313685-44313707 ATCAAGGCTCAGAGAAGGGGTGG - Intronic
906777471 1:48542992-48543014 CCCACTGTTCAGAGAAGATAAGG + Intronic
907321274 1:53603907-53603929 GCTAAGGCTCAGAGAAGGAAAGG + Intronic
907427277 1:54388331-54388353 GCCAGGGCTCAGAGAAGTGAAGG - Intronic
907682263 1:56575703-56575725 ACCATGTCTCAGAAAAGGGAAGG - Intronic
908157954 1:61375684-61375706 GCCATGACTCAGAGAAGAGAGGG - Intronic
908419858 1:63949325-63949347 CCCACCCCCCAGAGAAGGAAAGG + Intronic
908543852 1:65146567-65146589 CCCAGGACTCAGAGAAGGTGAGG - Intergenic
910459869 1:87437265-87437287 CCCATGGCTCTGAGATGTGAGGG + Intergenic
911044287 1:93615897-93615919 CCCAGGCCTGAGAAAAGGGAGGG + Intronic
912449849 1:109761976-109761998 CCCCGGGCTGAGGGAAGGGAGGG + Intronic
913118413 1:115717651-115717673 CACACGGCTAAGAGAAGAAAAGG - Intronic
914317086 1:146523535-146523557 CCCATGGCTCTGAGATGTGAGGG + Intergenic
914434603 1:147648752-147648774 CCCATGGCTGAGAGTAGGAAGGG - Intronic
914497269 1:148209825-148209847 CCCATGGCTCTGAGATGTGAGGG - Intergenic
915977324 1:160400104-160400126 CCTAGGGGTCCGAGAAGGGAGGG - Intergenic
916059732 1:161090028-161090050 ACCAAGGCCCAGAGAAGGGGAGG + Intergenic
916922984 1:169487986-169488008 CCCAAGCCTCAGGGAAGGGATGG - Intergenic
920347122 1:205313644-205313666 CCCGAGGCTCTGAGAAGGGGTGG - Intronic
920840601 1:209550675-209550697 ACCAAGGCCCAGAGAGGGGAAGG - Intergenic
921544666 1:216460389-216460411 GCCAGGGCTCAGAGAAGGCATGG - Intergenic
922418803 1:225445761-225445783 CCTGAGGCCCAGAGAAGGGATGG - Intergenic
924089480 1:240487537-240487559 CCTAAGGCTCAGAGAAGTGGGGG + Intergenic
1062901891 10:1152810-1152832 CCCACGGCACACAGGAGGCAGGG + Intergenic
1062901913 10:1152890-1152912 CCCACGGCACACAGGAGGCAGGG + Intergenic
1063154358 10:3364961-3364983 CCCACGGCTCATTTAAGGGAAGG - Intergenic
1067091024 10:43265990-43266012 CTCACTGCTCTGAGCAGGGAGGG + Intronic
1067413370 10:46084575-46084597 CCCAGGGCACAGAGCAGGGTGGG + Intergenic
1069075499 10:64034597-64034619 CTCAAGGCTGGGAGAAGGGAAGG + Intergenic
1069869912 10:71526839-71526861 CCCACGTCACAGAGCAGAGATGG + Intronic
1069994414 10:72333700-72333722 CCCCCTGCCCACAGAAGGGAAGG - Exonic
1070675746 10:78410232-78410254 ACCAAGGCACAGAGGAGGGAAGG - Intergenic
1070987611 10:80701858-80701880 CCCAGGGATCAGAGAGGGAAGGG + Intergenic
1071987156 10:91063384-91063406 CACATGGCCCAGAGAAGAGAAGG + Intergenic
1072863518 10:99032288-99032310 CCCACTGCTTAAAGAAGGGGTGG + Intronic
1073475240 10:103748362-103748384 CCCGGGGCTCAGGGAAAGGAAGG - Intronic
1075025200 10:118978990-118979012 CCCAAGTCTCAGGCAAGGGAAGG + Intergenic
1075086922 10:119419837-119419859 CCCACGGCTCAGAGAAGGGAGGG - Intronic
1075580578 10:123614952-123614974 CCCACAGTTCAGAGCAGGGGTGG + Intergenic
1075654140 10:124150368-124150390 CACACAGCTCAGAGTAGGGCTGG + Intergenic
1076904631 10:133355880-133355902 CCCAGGGCCCAAAGCAGGGAGGG + Intronic
1077517707 11:3011877-3011899 GCCTCGGCTCAGAGAAGGAGAGG + Intronic
1077538094 11:3134029-3134051 CCCAAGCCTCGGAGGAGGGAAGG + Intronic
1078148115 11:8735997-8736019 ACCACGGCCAAGAGAAGGGCAGG + Intronic
1078196729 11:9142918-9142940 CCCACAGCCCAGAGTTGGGAGGG + Intronic
1078361255 11:10669671-10669693 CCAAAGGCTCAAGGAAGGGATGG - Intronic
1080842066 11:35993310-35993332 CTCAGGGCACAGAGAAGGGCTGG + Intronic
1081686474 11:45046772-45046794 CCAAAGGCTCAGAGGTGGGACGG + Intergenic
1082809943 11:57473761-57473783 GCAGAGGCTCAGAGAAGGGAGGG + Intronic
1083397254 11:62400394-62400416 GCCAGGGCTCAGAAAAGGAACGG - Intergenic
1083487895 11:62995144-62995166 CCCACAGTTCAGAGAGAGGAAGG - Intronic
1083593917 11:63910068-63910090 CCCAGGGCTGGGAGAGGGGAGGG + Exonic
1083781096 11:64917879-64917901 CCGACGGCAGAGAGAAGGGAGGG - Intronic
1085149999 11:74243662-74243684 ACCAAGGCCCAAAGAAGGGAAGG + Intronic
1085782224 11:79419822-79419844 CTGAAGGCCCAGAGAAGGGAAGG - Intronic
1087818567 11:102686222-102686244 CCCAGAGGTCAAAGAAGGGAGGG + Intergenic
1089330891 11:117688311-117688333 CCCACTGCTTGGAGATGGGAGGG - Intronic
1090351929 11:126113391-126113413 CCCACACCTGAGAGAATGGAAGG + Intergenic
1091251265 11:134146185-134146207 CCCACTGCACAGTGAAGGGAAGG + Intronic
1091847958 12:3672023-3672045 CCCAAAGCTCAGAGAAGGGAAGG - Intronic
1092126544 12:6078770-6078792 GTCACGGCTCTGAGAGGGGAGGG - Intronic
1092688827 12:11084160-11084182 CCCACGGAACAAAGGAGGGAAGG - Intronic
1092986991 12:13855307-13855329 ACTAAGGCTCAGAGAAGTGAAGG + Intronic
1093013228 12:14130012-14130034 CCCAGGTCTCAGAGAAATGAGGG - Intergenic
1094435782 12:30419319-30419341 CCCAAGGCTGAGGGGAGGGAAGG + Intergenic
1096624808 12:52888075-52888097 ACCAAGGCCCAGAGAAGGCAGGG + Intergenic
1096693413 12:53334736-53334758 CCCAAGGCACAGAGTTGGGAAGG - Intronic
1096749703 12:53751214-53751236 CGCAGGGCTCAGAGGAGGGGCGG - Intergenic
1101405112 12:104421724-104421746 CCTAAGGCTCAGAGAAATGATGG + Intergenic
1101645938 12:106631007-106631029 ACTAAGGCTCAGAGAAGTGAAGG - Intronic
1102636602 12:114329975-114329997 ACCAAGGCTCAGAGAGGGGAAGG - Intergenic
1103827038 12:123747288-123747310 CACACAGCTCAGAGACTGGAAGG - Intronic
1104976074 12:132552545-132552567 CCCACGGGACAGACAAAGGATGG + Intronic
1105752393 13:23433508-23433530 CCCAAGGCTCAGGGGACGGATGG + Intronic
1107282403 13:38751587-38751609 CCTGGGGCTCAGAGGAGGGAGGG - Intronic
1109276738 13:60311902-60311924 CCCATGGCACAGAGCAGAGAAGG + Intergenic
1109369252 13:61399951-61399973 CCCACTGCTCAGAAAAGGGCTGG - Intergenic
1113040838 13:106102254-106102276 CACAGGTCTCAGAGGAGGGAAGG + Intergenic
1113796379 13:113061095-113061117 CCCAGGGATGAGAGAAGGGCTGG + Intronic
1114183128 14:20381850-20381872 GCCCCGGCTCAAAGAAGGGAAGG + Intronic
1117378559 14:55137808-55137830 CCAACGTCTCAGATCAGGGAGGG - Intronic
1118707111 14:68490782-68490804 CCCAAGGCCAAAAGAAGGGAGGG + Intronic
1119846258 14:77832520-77832542 CCTCAGGCTCAGAGGAGGGAGGG - Intronic
1119892279 14:78191864-78191886 CACACAGCTCAAAGAGGGGAAGG - Intergenic
1121011618 14:90523266-90523288 CTCACTGATCAGAGAAGGGCGGG + Intergenic
1121496148 14:94392389-94392411 ACCAAGGCTCAGAGAACTGAGGG - Intergenic
1122334678 14:100963686-100963708 CCCACGGACCAGGGCAGGGAGGG - Intergenic
1122350017 14:101083753-101083775 CCCAAGGCTAAGTGAAAGGAAGG + Intergenic
1122931220 14:104933759-104933781 CCCGCGGCTGAGTGAGGGGAGGG + Exonic
1123043642 14:105500734-105500756 CCCCCAGCTCAGAGCAGGCATGG + Intergenic
1125250396 15:37695599-37695621 CCAACGGCTGGGAGAAGGGGTGG - Intergenic
1126109205 15:45165943-45165965 CCCTTTGCTCAGAGAAGGGCTGG - Intergenic
1127618537 15:60710805-60710827 CCCAGGGCACAGAAGAGGGAGGG + Intronic
1127815079 15:62601065-62601087 CACAAGGGTCAGAGAAGGTATGG - Intronic
1128259674 15:66224176-66224198 ACCAAGGCTCAGAGAGGTGAAGG - Intronic
1128434979 15:67637777-67637799 CCCAGGCCTCAGTGCAGGGAGGG - Intronic
1130599340 15:85265144-85265166 CCAACGGCTCAGAGAATGTCTGG + Intergenic
1131108510 15:89750358-89750380 CCCAGGGCTCCAAGAAGCGAAGG - Intronic
1133121407 16:3611134-3611156 CCCACGGCTCACAGCAGGCGAGG + Intronic
1133267134 16:4591987-4592009 ACCAAGGCTCAGAGAGGGAAGGG + Intronic
1134251729 16:12578790-12578812 CCCAGGGCTCAGTGTAGGGCTGG - Intergenic
1134252960 16:12587675-12587697 CCCACAGCAGAGGGAAGGGAAGG - Intergenic
1134515920 16:14886841-14886863 CCCACTGCTCAGAGACGGCGAGG + Exonic
1134703592 16:16285485-16285507 CCCACTGCTCAGAGATGGCGAGG + Exonic
1134963951 16:18426629-18426651 CCCACTGCTCAGAGATGGCGAGG - Exonic
1134968238 16:18509165-18509187 CCCACTGCTCAGAGATGGCGAGG - Intronic
1135350725 16:21726846-21726868 CCCACGGCCCAAAGGAGGGGAGG + Intronic
1135537417 16:23304812-23304834 ACTACGGCTCAGGGAGGGGAAGG - Intronic
1136098425 16:27975313-27975335 CCCAGGGCACCGAGAAGGGCAGG + Intronic
1136505274 16:30698894-30698916 CGAAAGGCTGAGAGAAGGGAGGG - Intronic
1138536109 16:57661093-57661115 ACCGAGGCTCAGAGAAGGGCCGG - Intronic
1138601113 16:58055124-58055146 CCCAAGGCTCAGAGAGGTGAAGG + Intergenic
1139442060 16:66973343-66973365 CGCACAGCCCAGAGAAGGCAGGG - Exonic
1140048243 16:71456804-71456826 TCCCCGTCTCAGAGAAGGGCTGG + Exonic
1140781557 16:78301612-78301634 CCCACGGCTCTGAGCTGGAAAGG + Intronic
1142108460 16:88318651-88318673 CCCACGGCACAGGCCAGGGAGGG - Intergenic
1142112896 16:88341593-88341615 CGCACGGCTCACAGCTGGGACGG + Intergenic
1142126969 16:88415088-88415110 ACCGAGGCTCAGAGAGGGGAAGG - Intergenic
1142201984 16:88765452-88765474 CTCAAGGCACAGAGAGGGGAGGG - Intronic
1142222163 16:88860845-88860867 CCCTCTGCTCAGAGACGGGCCGG - Intronic
1142374024 16:89697664-89697686 CTCACGGCGCAGAGAGAGGAAGG + Exonic
1142390421 16:89796223-89796245 CCCACGGAGCAGAGAAGCGAAGG + Intronic
1142485683 17:246430-246452 CCTGCGGCTCAGAGAAGAGGAGG - Intronic
1142593266 17:1017043-1017065 CGCCCTGCCCAGAGAAGGGATGG + Intronic
1143106364 17:4532441-4532463 CCTATGGCCCAGAGAAGGCATGG + Intronic
1143217641 17:5236998-5237020 ACTGAGGCTCAGAGAAGGGAAGG - Intergenic
1147588146 17:41664895-41664917 ACTGAGGCTCAGAGAAGGGAAGG - Intergenic
1148344451 17:46894309-46894331 CCCAAGGCCCAGAGAAGGAAAGG - Intergenic
1148438173 17:47698034-47698056 CCCACTTTTCAGAGGAGGGATGG - Intronic
1148736197 17:49866333-49866355 ACCAAGGCTCAGAGAAGTTAAGG + Intergenic
1148767299 17:50046805-50046827 CACACAGCAGAGAGAAGGGAGGG - Intergenic
1148770235 17:50062265-50062287 CTCAGGGCTCAGAGAAGGAAAGG + Intronic
1148779265 17:50112461-50112483 CCCAGGGCTCAGAGCTGGGCTGG - Intronic
1148966665 17:51441508-51441530 CCCAGGGCCCAGAGGAGGAAGGG + Intergenic
1149614561 17:57987733-57987755 CCCGCGGCCCAGAGAAAGGAGGG - Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1150729133 17:67676681-67676703 CCTTCTGCTCAGAAAAGGGAGGG - Intronic
1151989364 17:77564400-77564422 CTCTAGGCTCAGAGAAGGGAGGG - Intergenic
1152264817 17:79288131-79288153 CCCGGGGTGCAGAGAAGGGAAGG - Intronic
1152391415 17:80006061-80006083 CCCACCGCTCAGAGTGGCGATGG + Intronic
1152428001 17:80229056-80229078 CCCTCGGCTCTGAGAAGGTTTGG - Intronic
1152535436 17:80948127-80948149 AGCACGGCTGAGAGAAGTGAAGG + Intronic
1157274929 18:46303774-46303796 CCCAGGGCACAGAGAAGCCAGGG + Intergenic
1160190950 18:76713545-76713567 TCCAAGGCTCAGAGCAGGGCTGG - Intergenic
1160855134 19:1213853-1213875 CCCACGGCTCAGAGCAGGACTGG - Intronic
1161452862 19:4356204-4356226 ACCAAGGCTCTGAGAGGGGAGGG - Intronic
1161682261 19:5686296-5686318 CCCGAGGCTCAGAGTAGGGGGGG + Intronic
1162011042 19:7815330-7815352 CCCACAGTCCAGAGAGGGGATGG + Intergenic
1162045978 19:8000745-8000767 CCCATGGCCCACAGAAGGGCAGG + Intronic
1162057128 19:8071489-8071511 CCCAAGGCTCAGACAGGGAAGGG + Intronic
1162199314 19:9009416-9009438 CCCTGGGCTCAGGGAAGGGCTGG - Intergenic
1162429299 19:10617706-10617728 ACCGAGGCTCAGAAAAGGGAAGG - Intronic
1166297874 19:41897515-41897537 CCCCTGCCTCAGGGAAGGGAGGG + Intronic
1166826545 19:45613438-45613460 ACCGAGGCTCAGAGAAGGGGTGG + Intronic
1166950267 19:46422549-46422571 GCCAAGGCTCAGAGAGGTGAAGG - Intergenic
1167650551 19:50726258-50726280 CCCGAGGCTCACAGAGGGGAAGG - Intergenic
1167684372 19:50946913-50946935 CCCAGGGCACAGAGAAGAAATGG + Intronic
1168322873 19:55520825-55520847 ACTGAGGCTCAGAGAAGGGAGGG - Intergenic
926972788 2:18483773-18483795 ACCAAGGCCCAGAGAGGGGAAGG - Intergenic
927490457 2:23517862-23517884 CACAAGGCTCAAAGAATGGAAGG - Intronic
928720899 2:34119667-34119689 CACACACCCCAGAGAAGGGAAGG + Intergenic
932515291 2:72340930-72340952 CCTACTGGTCAGAGAAGGGACGG + Intronic
933811654 2:86036454-86036476 TCCACAGCTGGGAGAAGGGAGGG + Intronic
933990899 2:87633190-87633212 CCCAGGGGGCAGAGAAGGGCAGG + Intergenic
934612559 2:95751987-95752009 CCCACAGCTCACAGGAGGGCTGG + Intergenic
934648355 2:96072436-96072458 CCCACAGCTCACAGGAGGGCTGG - Intergenic
934759271 2:96844542-96844564 CCCACAGCACAGGGAAGGGAAGG - Intronic
934841588 2:97627457-97627479 CCCACAGCTCACAGGAGGGCTGG - Intergenic
935085615 2:99841721-99841743 GCCATGGCTCAGAGAAGTGAAGG + Intronic
936153786 2:110035612-110035634 CCCACCACTCAGATAAGGGCTGG - Intergenic
936190899 2:110335803-110335825 CCCACCACTCAGATAAGGGCTGG + Intergenic
936302943 2:111317633-111317655 CCCAGGGGGCAGAGAAGGGCAGG - Intergenic
937316569 2:120935476-120935498 CCCACAGCCCAGAGATGGGGAGG - Intronic
938622742 2:133073548-133073570 ACCACAGCTCACAGAAGGGAAGG + Intronic
938899994 2:135791665-135791687 CCCAGGGCTCATAAGAGGGAGGG + Intronic
941584325 2:167337948-167337970 CCCATGTGTCAGTGAAGGGAAGG - Intergenic
942232014 2:173869091-173869113 ACCAAGGCTCAGAGGAGTGAAGG - Intergenic
944214201 2:197237915-197237937 ACCAAAGCTCTGAGAAGGGAGGG - Intronic
946872627 2:224098095-224098117 CCCATGTATCAGAGAATGGAAGG + Intergenic
947428890 2:230008241-230008263 ACCAGGGCTGAGAGAAGAGAAGG - Intronic
948752244 2:240139495-240139517 CCCAAGGATCTGAGAGGGGATGG - Intronic
948804125 2:240446064-240446086 CCCACGGCACAGAGAAAGTCCGG + Intronic
948806434 2:240455341-240455363 CCCAGGGATCAGGGAAGAGAGGG + Intronic
948917273 2:241040670-241040692 ACCAAGGCCCAGAGAGGGGAAGG - Intronic
1169855609 20:10099227-10099249 CCCACCTCAAAGAGAAGGGAGGG + Intergenic
1171482665 20:25465642-25465664 CCCACATCACAGAGCAGGGACGG + Intronic
1172448239 20:35004105-35004127 CAGGAGGCTCAGAGAAGGGAAGG + Intronic
1172591693 20:36122385-36122407 GCCACTGCCCAGAGAAAGGATGG - Intronic
1172841511 20:37905007-37905029 ACCAAGGCTCAGAGAGGTGAAGG + Intronic
1173468232 20:43301460-43301482 TCCAGGACACAGAGAAGGGAAGG + Intergenic
1173563707 20:44023966-44023988 CCACCGGATCAGAGAGGGGACGG - Intronic
1173794401 20:45848951-45848973 CACACTGCTCAGAGAAGTGAAGG - Intronic
1174258900 20:49278783-49278805 ACGACGGCACAAAGAAGGGAAGG - Intergenic
1175537825 20:59727437-59727459 GCCACAGCTTAGAGAAGGGATGG + Intronic
1178406646 21:32329611-32329633 CCAAGGACTCAAAGAAGGGAAGG + Intronic
1179878864 21:44285259-44285281 ACCGAGGCTCAGAGAAGGAAAGG + Intergenic
1179950799 21:44707916-44707938 CCCAGGGCTCCGGGAAGGGTGGG - Intronic
1181391741 22:22588122-22588144 CCCCCGCCTCAGAGGAGGGCAGG - Intergenic
1181440979 22:22935091-22935113 CCCAAGGCACAGGGAAGGAATGG - Intergenic
1181461401 22:23088279-23088301 CCCACAGCTCAGAGCATGCAGGG - Intronic
1181540202 22:23568954-23568976 ACCAAGGCACAGAGAAGGCAAGG - Intergenic
1181543540 22:23587533-23587555 CCTGGGGCACAGAGAAGGGAGGG + Intergenic
1181957655 22:26599806-26599828 CCCAGGGCACAGAGCAGGAAGGG - Intronic
1182041572 22:27242330-27242352 CCTAGGGCTCAGAGAGGGGCCGG - Intergenic
1182118921 22:27774460-27774482 CCCACGGGTCAGACTAGGGCAGG + Intronic
1182282544 22:29225731-29225753 GACACGGCTCAGAGCAGGAAGGG - Intronic
1182417591 22:30231407-30231429 ACCAAGGCTCAGAGAGGTGAAGG + Intergenic
1183577563 22:38701345-38701367 AGCCCGGCACAGAGAAGGGAGGG - Intronic
1183862452 22:40679751-40679773 CCCACAGCCCAGAGGAGGGAGGG - Intronic
1184239869 22:43206444-43206466 CCCACAGCACAGAGGAGGGCAGG - Intronic
1184373419 22:44097107-44097129 CACACAGCTCAGAGATGGCATGG + Intronic
1184445812 22:44546169-44546191 CTCAACGCTCAGAGAAGTGAGGG - Intergenic
1184827808 22:46964927-46964949 CCCACCGCTCAGAGCAAGAACGG - Intronic
1184901175 22:47447549-47447571 CCCTCGGCTCAGAGATGCAAGGG + Intergenic
1185387977 22:50545140-50545162 TCCTCAGCTCAGATAAGGGAAGG + Intergenic
950085459 3:10254431-10254453 AGCACGGATGAGAGAAGGGAGGG - Intronic
950109369 3:10408666-10408688 ACCAAGGCCCAGAGAGGGGAAGG - Intronic
950424566 3:12918124-12918146 ATCAGGGCTCAGAGAAGGAAGGG - Intronic
952957177 3:38564667-38564689 ACCAAGGCTCACAGCAGGGAGGG - Intronic
953085630 3:39664003-39664025 ACTAACGCTCAGAGAAGGGAAGG + Intergenic
953876912 3:46671738-46671760 GCCAAGGCCCAGAAAAGGGAGGG - Intronic
954456971 3:50604887-50604909 ACCGAGGCTCAGAGCAGGGAAGG - Intergenic
956083142 3:65580981-65581003 CCCTAAGCTCAGAGAAGGGCTGG - Intronic
956346371 3:68283746-68283768 CCCACAGCACAAAGCAGGGATGG + Intronic
959648995 3:108733583-108733605 GCCACGGCTCAGAATAGGGCAGG + Intergenic
961670480 3:128524661-128524683 TCAGAGGCTCAGAGAAGGGAAGG - Intergenic
966869153 3:184278631-184278653 GCCAAGGGTCAGAGCAGGGAAGG + Intronic
967969242 3:194986950-194986972 CCCACGGCTCTGGGGTGGGAGGG - Intergenic
968454159 4:688790-688812 CCCAGGGCACAGAGCAGGGCTGG - Intronic
968614631 4:1571810-1571832 GCCTCGGATCAGAGAAGGGTGGG - Intergenic
970225381 4:13851776-13851798 CCCAAGGCTGAGAGGAGAGAGGG + Intergenic
972563189 4:40246624-40246646 CCCAGGGCTCAGCACAGGGAAGG + Exonic
975801409 4:78062175-78062197 CACATGGCTCAGAGTAGGGGAGG + Intronic
976231261 4:82845873-82845895 ACCAAGGCCCAGAGAAGTGAAGG + Intronic
977115273 4:93016544-93016566 CCAACTGCCCAGAGAGGGGATGG - Intronic
978207439 4:106094667-106094689 CCCAGGGCACAGAGAATAGAGGG - Intronic
980766889 4:137319102-137319124 CCCATGGCAAAAAGAAGGGAGGG + Intergenic
983539909 4:168898222-168898244 CCCTCGCCTCAGAGAAAAGAAGG + Intronic
985295292 4:188431407-188431429 CCCAGGGCTGAGAGAGGGAATGG + Intergenic
985301640 4:188496384-188496406 CCCAAAGCTCAGAGCTGGGAGGG - Intergenic
985619956 5:948964-948986 CCCACGGCTGAAAGACGGGAGGG + Intergenic
985774413 5:1833419-1833441 CCCACAGCTCTGAGAAGGCCAGG - Intergenic
986462285 5:7983949-7983971 CCCAGGGCTCTGAGGAGAGAAGG + Intergenic
986469624 5:8060921-8060943 CCCAAGGCCCCGAGAAGGGCAGG - Intergenic
992098999 5:73388382-73388404 CCGAGGGCTAAGAGAAGGGAAGG + Intergenic
993021592 5:82597922-82597944 CCCAGGGCTCAGAGAAGGACTGG - Intergenic
995862002 5:116650813-116650835 CCCAAGGCCCACAGCAGGGAAGG - Intergenic
996016841 5:118548574-118548596 TCCTCTGCTCAGACAAGGGATGG + Intergenic
997212167 5:132083245-132083267 CCCAAGGCCCAGAGAGGGCAGGG + Intergenic
997262666 5:132476506-132476528 GTCACTGGTCAGAGAAGGGAGGG + Intergenic
997975913 5:138441122-138441144 CACATGGCACAGAGAGGGGAGGG + Intronic
999147877 5:149407713-149407735 ACTATGGCCCAGAGAAGGGAGGG - Intergenic
999255309 5:150206712-150206734 CCTGAGGTTCAGAGAAGGGAAGG - Intronic
999304135 5:150508908-150508930 ACTGAGGCTCAGAGAAGGGAAGG + Intronic
999377003 5:151093886-151093908 ACTAAGGTTCAGAGAAGGGAAGG + Intergenic
999802284 5:155049246-155049268 CCCAAGGCTGAAAGAAGCGATGG - Intergenic
1000015641 5:157273289-157273311 ACCAAGGCTCAGAAAAGAGAAGG - Intronic
1001271949 5:170319499-170319521 GCCACCTCTCAGAGAAGGGCAGG - Intergenic
1001302104 5:170541123-170541145 ACCAAGGCTCAGAGAGTGGAAGG - Intronic
1001576468 5:172767703-172767725 AGCACAGCTCAGAGATGGGAAGG + Intergenic
1004457331 6:15803286-15803308 TCCAGGGCTCAGTGTAGGGAGGG + Intergenic
1006113511 6:31763037-31763059 CCCATGGCTCTGAGGTGGGAAGG - Exonic
1006375262 6:33668375-33668397 CCCAAGGCTTAGAGATGGGTGGG - Intronic
1007313071 6:40962045-40962067 ACCAAGGCTCAGAGAAAGAAGGG - Intergenic
1008703241 6:54127028-54127050 TCAAGGGCTCAGAGATGGGAAGG - Intronic
1010400645 6:75442138-75442160 CCCACAGCTCAGACAATGGGTGG + Intronic
1015770313 6:136761830-136761852 CCGACAGCACAGAGAAGCGATGG + Intronic
1016897441 6:149067096-149067118 CCCAATGCTCAGACAATGGAAGG + Intronic
1017813873 6:158002999-158003021 GCCACAGCTCAGTGCAGGGAGGG + Intronic
1019314597 7:378744-378766 CCCAAGGCCAAGAGCAGGGAAGG + Intergenic
1019326362 7:440275-440297 GCCACTGCTCAGTGCAGGGAGGG - Intergenic
1019698154 7:2459514-2459536 TCCTGGGCTCAGAGAAGAGATGG - Intergenic
1019701243 7:2475884-2475906 CCCAAGGCCCAGCGAGGGGAGGG + Intronic
1019707923 7:2505211-2505233 CCCAGGGGCCAGAGAGGGGAGGG - Intergenic
1021643223 7:22761156-22761178 CCAAAGGACCAGAGAAGGGATGG - Intergenic
1021717602 7:23473935-23473957 CTCACGGCTCACAGTGGGGAGGG + Intergenic
1022148570 7:27574261-27574283 CCCACAGCTTAGAAAAGGGGAGG + Intronic
1023848880 7:44139642-44139664 CCCATGGCGCAGGGAAGGGTTGG + Intronic
1023995402 7:45156532-45156554 CCTACGGCTCAGAGGAGTGGAGG + Intergenic
1024504091 7:50146711-50146733 CAGAGGGCTGAGAGAAGGGAAGG - Intronic
1026916183 7:74121458-74121480 GCCACGGCAGAGAGAAGGCAGGG - Exonic
1027046097 7:74992228-74992250 ACCCAGGATCAGAGAAGGGATGG - Intronic
1027221392 7:76216485-76216507 ATCAAGGCTCAGAGAAGGAAGGG - Intronic
1029386730 7:100248366-100248388 ACCCAGGATCAGAGAAGGGACGG + Intronic
1029600107 7:101558390-101558412 CCCCTGGCTCAGGGATGGGATGG - Exonic
1029608877 7:101616053-101616075 ACCAAGGCCCAGAGAGGGGAAGG + Intronic
1029784401 7:102772936-102772958 CCCAGGGCTCAGAGAAGGTGAGG - Intronic
1030186695 7:106769465-106769487 CCTATGGCTCAGAGGACGGATGG + Intergenic
1030388185 7:108891747-108891769 TCCAAAGCTGAGAGAAGGGAGGG - Intergenic
1030755705 7:113285499-113285521 CCCACAGCTCAGTGAATGGGAGG + Intergenic
1031578612 7:123444950-123444972 CCCATAGCTCAGAGAAGAAAGGG - Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1033039544 7:137905558-137905580 CCCAGGGCTTAGGGAAGGGAAGG + Intronic
1033045891 7:137961906-137961928 CCCATGGTTCAGAAAAGTGAGGG - Intronic
1033569612 7:142615012-142615034 CCCACACCTCAGCTAAGGGATGG - Intergenic
1034111060 7:148537834-148537856 CCCAAGGCTCGGAGAAGTTAAGG - Intergenic
1034441891 7:151089882-151089904 ACTGAGGCTCAGAGAAGGGAGGG + Intronic
1035040147 7:155921169-155921191 CCCTGGGCTCAGAGCAGGGAGGG + Intergenic
1035307836 7:157944749-157944771 CCCTTGGCTTAGAGAAGAGAGGG - Intronic
1035628234 8:1089581-1089603 CCCACTGCTCAGAGTTGGGTTGG + Intergenic
1036805379 8:11828423-11828445 CACAGGGCTCAGAGAAGGGAAGG + Intronic
1037992232 8:23329198-23329220 GCCATGACTCAGAGAATGGATGG + Intronic
1040867225 8:52060267-52060289 TGCAGGTCTCAGAGAAGGGATGG - Intergenic
1042224384 8:66504143-66504165 CCCACTGTGCAGAGAAGAGATGG + Intronic
1043416790 8:80059416-80059438 CCCAAAGCTAAGAGAAGGAAGGG + Intronic
1047512719 8:125528008-125528030 CCCAAGGCTCCAGGAAGGGAAGG + Intergenic
1049069442 8:140345430-140345452 CTCAGGGCCCAGAGATGGGACGG - Intronic
1049216036 8:141408833-141408855 CCCAGGGCTCAGGGCAGGGCAGG + Intronic
1049430482 8:142560845-142560867 ACCCCGGCTCAGAAAAAGGAAGG - Intergenic
1049546683 8:143235113-143235135 ACCACGGCTCAGAGAGGGCAGGG - Intergenic
1053453240 9:38210949-38210971 CCCACCACACAGAGAAAGGAAGG + Intergenic
1053479938 9:38408761-38408783 ACCAGGGCCCAGAGAGGGGAAGG + Intergenic
1054938370 9:70713343-70713365 CTCACTGACCAGAGAAGGGAAGG - Intronic
1054940061 9:70731336-70731358 CTCACTGACCAGAGAAGGGAAGG - Intronic
1055470180 9:76603058-76603080 CCCAGTGCTCAGAGGAGAGATGG - Intergenic
1057756894 9:97846400-97846422 GCCAGGGCTCAGGGAAGGCAGGG + Intergenic
1057904525 9:98973944-98973966 CCTGAGGCTCAGAGAAGGGAAGG + Intronic
1058981333 9:110173521-110173543 CCCAGGGCTCGGTGATGGGATGG - Intergenic
1059335148 9:113564480-113564502 ACCGAGGCTCAGAGAGGGGAAGG + Intronic
1059454667 9:114392249-114392271 TCCAAAGCTCAGAGAAAGGAAGG - Intronic
1060089505 9:120730690-120730712 ACCAAGGCTCAGAGCAGGAAAGG + Intergenic
1060514638 9:124258122-124258144 CCCGCGGCCCGGAGAAGGGCGGG + Intronic
1060660928 9:125404937-125404959 GCCAAGGCTCAGAGCAGCGAAGG + Intergenic
1060814599 9:126627944-126627966 CCCAGGTCTCAGGGATGGGAAGG + Intronic
1060872192 9:127051397-127051419 ACCAAGGCCCAGAGAAAGGAAGG - Intronic
1061388305 9:130303279-130303301 CCCAGGACTCAGAGAGAGGAAGG + Intronic
1061669716 9:132182041-132182063 CCGGCAGCCCAGAGAAGGGAGGG + Intronic
1061873998 9:133534969-133534991 CCCACTGCTCAGAGTGGGGCTGG + Intronic
1061918596 9:133769952-133769974 TCCACAGCTCAGAACAGGGAAGG - Intronic
1061974838 9:134062793-134062815 CCCACGGGTCTGGGAAGGGCAGG + Intronic
1062110174 9:134777834-134777856 CCCAGGACTCAGGGCAGGGAGGG + Intronic
1203571989 Un_KI270744v1:140541-140563 CCCACGGCCCAGGGAAGGTGCGG + Intergenic
1186384455 X:9094620-9094642 CCTGTGGCTCAGAGAAGGGCAGG + Intronic
1186594315 X:10964426-10964448 CCCACGTCACAGAAAAAGGAAGG + Intergenic
1189305805 X:39985782-39985804 CCTTGAGCTCAGAGAAGGGAGGG + Intergenic
1189920739 X:45900947-45900969 CCTGCTGCTCAGTGAAGGGAGGG + Intergenic
1190379897 X:49829414-49829436 CCCTGGCCTCAGAGAAGGAAGGG + Intronic
1190534048 X:51408270-51408292 CCCACTGCTGAGGGATGGGAAGG - Exonic
1193046934 X:77063837-77063859 CACACAGCTGGGAGAAGGGAGGG - Intergenic
1193599244 X:83488878-83488900 CCCACGGAGCAGAGAATAGAAGG + Intergenic
1195575950 X:106450820-106450842 CTCAAAACTCAGAGAAGGGAAGG - Intergenic
1198182476 X:134223428-134223450 CCAAGGGCTCAAGGAAGGGATGG - Intergenic
1198231032 X:134689680-134689702 ACCAAGGCTCAGAGAAGGGCAGG - Intronic
1199266518 X:145834118-145834140 ACTGAGGCTCAGAGAAGGGAAGG - Intergenic
1199937707 X:152591807-152591829 CTCATGACTCAGAGAAGGAAAGG + Intergenic