ID: 1075087264

View in Genome Browser
Species Human (GRCh38)
Location 10:119421968-119421990
Sequence AGAGTCCACTGGATGGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 126}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075087264_1075087269 4 Left 1075087264 10:119421968-119421990 CCAGAAACCATCCAGTGGACTCT 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1075087269 10:119421995-119422017 AAATCAGCCCCATAGGGAAGAGG No data
1075087264_1075087268 -2 Left 1075087264 10:119421968-119421990 CCAGAAACCATCCAGTGGACTCT 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1075087268 10:119421989-119422011 CTTAGCAAATCAGCCCCATAGGG No data
1075087264_1075087270 7 Left 1075087264 10:119421968-119421990 CCAGAAACCATCCAGTGGACTCT 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1075087270 10:119421998-119422020 TCAGCCCCATAGGGAAGAGGAGG No data
1075087264_1075087267 -3 Left 1075087264 10:119421968-119421990 CCAGAAACCATCCAGTGGACTCT 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1075087267 10:119421988-119422010 TCTTAGCAAATCAGCCCCATAGG No data
1075087264_1075087273 12 Left 1075087264 10:119421968-119421990 CCAGAAACCATCCAGTGGACTCT 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1075087273 10:119422003-119422025 CCCATAGGGAAGAGGAGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075087264 Original CRISPR AGAGTCCACTGGATGGTTTC TGG (reversed) Intronic
902879051 1:19358872-19358894 AGAGTGCACTGGGTGGGTACAGG + Intronic
905865722 1:41375574-41375596 AGGGCCCACAGGATGGATTCTGG - Intronic
906194298 1:43920402-43920424 AGAGTGCATCGGATGGCTTCTGG + Exonic
907371272 1:54005124-54005146 AGAGGCCTGTGGATGGTTTGGGG + Intergenic
914929997 1:151922517-151922539 AGAACCCACTGGGTGGTTACAGG - Intergenic
915101370 1:153503241-153503263 AGGCTTCACTGAATGGTTTCTGG - Intergenic
915545857 1:156597336-156597358 AGAGAACACTGGATGCTTTGTGG + Intronic
918096012 1:181334827-181334849 GGAAGACACTGGATGGTTTCAGG - Intergenic
918180936 1:182085695-182085717 AGAGTCTCTTGGATGGTTCCTGG + Intergenic
921022077 1:211244991-211245013 AGAGACCACTGTATAGATTCAGG + Intergenic
924120484 1:240792973-240792995 AGAGCCCCCAGGATGGTCTCTGG + Intronic
924358885 1:243214921-243214943 AGGGTCCACTGGATTATTGCCGG + Intronic
1071429952 10:85599330-85599352 ACTGTCCCCTGGTTGGTTTCAGG + Intergenic
1075087264 10:119421968-119421990 AGAGTCCACTGGATGGTTTCTGG - Intronic
1075443799 10:122499903-122499925 AGAATCCACTGCATCATTTCTGG - Intronic
1079016867 11:16876290-16876312 AGAGCCAAGTGGCTGGTTTCAGG + Intronic
1080264903 11:30390469-30390491 AGGGACCAAAGGATGGTTTCAGG - Intronic
1082774253 11:57233811-57233833 AGTGTTCACTGGATGCTTTGAGG + Exonic
1089341425 11:117760418-117760440 ACAGTCCTCTGTATTGTTTCTGG - Intronic
1089879791 11:121762704-121762726 TGAGTCCCCTGGATGTTTGCTGG - Intergenic
1090681591 11:129064987-129065009 AGGGAAAACTGGATGGTTTCTGG + Intronic
1092145102 12:6209372-6209394 CAACTCCACTGGATGTTTTCTGG + Intronic
1099178227 12:79447676-79447698 ACTATCCACTGGATAGTTTCTGG - Intronic
1099555501 12:84104294-84104316 AGAGTCGACTTTATGGTTACTGG + Intergenic
1099838937 12:87942034-87942056 AGGGACCACTGGATGGGATCAGG - Intergenic
1103920391 12:124396430-124396452 AATGTCCACTTGGTGGTTTCTGG - Intronic
1105334602 13:19454994-19455016 AGGGTCCACTGGATGGGTCATGG - Intronic
1106296880 13:28422582-28422604 AGAGTCCACCTGGTTGTTTCTGG - Intronic
1106440072 13:29758822-29758844 AGAGGCCAGTGAAGGGTTTCTGG + Intergenic
1107426241 13:40296044-40296066 AGACTCCACTGGGTGATTACAGG - Intergenic
1108003341 13:45924318-45924340 AGAGTCCCCTGGAGGGTTTGGGG - Intergenic
1110220486 13:73067693-73067715 AGAGTCCAATGCATGGAGTCTGG - Intronic
1114242061 14:20877180-20877202 AAAGTCCACTGGGTTCTTTCTGG - Intergenic
1114248928 14:20940797-20940819 AAAGACCACTGGATTCTTTCTGG - Intergenic
1117014759 14:51507436-51507458 AGAATCCACTGGAGGATATCTGG + Intronic
1129387989 15:75206503-75206525 AGAGGCCACTGGATGTTGACTGG + Exonic
1130146137 15:81275072-81275094 AGAGAGAACTGGAAGGTTTCTGG + Intronic
1133455874 16:5942076-5942098 AGAACCCACTGGGTGGTTACAGG - Intergenic
1147339873 17:39746950-39746972 AGAGTCCACTGGATGGGTGGAGG - Exonic
1149638124 17:58186368-58186390 AGAGGCGACTGGATGTTTACAGG + Intergenic
1149967001 17:61174866-61174888 AGAGTCCAATTGATGAATTCTGG + Intronic
1150838454 17:68585883-68585905 AGAGGACACTGTATGGTGTCAGG - Intronic
1151947865 17:77329348-77329370 AGAGGCCACTGGATGCTGACAGG + Intronic
1153926884 18:9842336-9842358 AGAGGCCACAGGATGGTCTAGGG + Intronic
1160070127 18:75621231-75621253 AGAGGCCACTGGCTGCTTTCTGG - Intergenic
1161797432 19:6395173-6395195 AGAGTCCTCAGGATGCTTTAAGG + Intergenic
1162680960 19:12340964-12340986 AAAGAACACTGGATGGTATCTGG + Intergenic
1162943090 19:14025863-14025885 AGTGTCAAGTGGATGGTTTCGGG - Intergenic
1164513645 19:28916561-28916583 AGAGGCTACTGGAAGGCTTCAGG - Intergenic
1167500699 19:49845620-49845642 AGACTGCATTGGTTGGTTTCTGG - Intergenic
928985456 2:37176841-37176863 AGAGTCTGCTGGAAGGTTTCTGG + Intronic
929852385 2:45604239-45604261 GGAGGCCACTGGAAGGTTTTGGG - Intronic
930862167 2:56086343-56086365 AGAGTATACTGGATCCTTTCAGG + Intergenic
931763427 2:65435511-65435533 AAAGTCCATTGGATTGTTGCTGG + Intergenic
935365192 2:102281854-102281876 AGAGGCCACTGTATGCTTTCAGG + Intergenic
936257049 2:110925935-110925957 AGAGGCCACTGTAGGGTTACTGG + Intronic
936473094 2:112816116-112816138 AGGCTCCACTGGATGGATTTAGG - Intergenic
936646429 2:114377542-114377564 AATGACCACAGGATGGTTTCAGG + Intergenic
937287194 2:120761177-120761199 AGACTCCACTGGCTGCATTCAGG + Intronic
937975357 2:127579028-127579050 AGAACCCAATGGATGGTTTAAGG + Intronic
940928253 2:159393234-159393256 AGAGGCCCCTGGATAGTGTCAGG + Intronic
942807427 2:179948516-179948538 GGTGTCCACTGGATGTCTTCAGG - Intronic
944093910 2:195945363-195945385 AGAGTTCACTGGGTGGGATCAGG + Intronic
947104917 2:226659420-226659442 AGAGGGAATTGGATGGTTTCTGG - Intergenic
947455157 2:230247416-230247438 AAAGTCTACTGGATGGTTGATGG - Intronic
1169750488 20:8987752-8987774 AGTGTCCACAGGCTGCTTTCAGG + Intergenic
1172176107 20:32972798-32972820 AGGGTGCCCTGGATGGTGTCCGG - Intergenic
1183383108 22:37500365-37500387 GGAGAGCACTGGAGGGTTTCGGG - Intronic
1183605712 22:38865960-38865982 GTAGCCCACTGGGTGGTTTCTGG - Exonic
950417183 3:12875405-12875427 AGTGTCCAGTGGACTGTTTCAGG - Intergenic
951379155 3:21961800-21961822 AGAGTGCACTGGATGGGATGGGG + Intronic
953127606 3:40106863-40106885 TGTGTCCACTTGATGCTTTCTGG + Intronic
953263459 3:41363045-41363067 AGAGTCCACTGCAAAGTTGCAGG - Intronic
954960215 3:54557989-54558011 AGAGTCCACAGAATGGCTCCAGG - Intronic
956212553 3:66816661-66816683 AGGGTCCATTGCATGGTTTGAGG + Intergenic
957240700 3:77657660-77657682 AGAGTGTATTGGATGATTTCTGG - Intergenic
960709880 3:120517517-120517539 AGAGACCACTGAATGGGTGCAGG - Intergenic
960960136 3:123064888-123064910 GGAAACCACTGGAGGGTTTCAGG + Intergenic
961409046 3:126704882-126704904 GGAACCCACTGGAGGGTTTCAGG - Intronic
965209343 3:165765500-165765522 TGAGTCCATTGTATGTTTTCTGG + Intergenic
966704459 3:182895715-182895737 AGAGCCCACTGGCTGCTTACAGG + Intronic
968793272 4:2684143-2684165 AGAGACAACTGAATGGTTGCAGG - Intronic
976110071 4:81663299-81663321 AGAGTCTATTTGATGTTTTCAGG + Intronic
976753419 4:88473628-88473650 ATAGTCCACTGAGTAGTTTCTGG - Intronic
977369277 4:96114654-96114676 AGAGTGCACTGCTTTGTTTCAGG - Intergenic
979874497 4:125870982-125871004 AGAGCCCAGTGGAAGGTTTCAGG - Intergenic
980210592 4:129782190-129782212 ACAGCCTACTGGATAGTTTCAGG - Intergenic
980793114 4:137645493-137645515 AGTGTACACTGTATGTTTTCAGG - Intergenic
985855492 5:2421424-2421446 AGAGTCCACTGGCAGGTGCCGGG - Intergenic
987818317 5:22931707-22931729 ATTTTCCACTGGCTGGTTTCGGG - Intergenic
989168046 5:38449557-38449579 AGAGACCACTAGGTGGTTTGGGG + Intronic
992009141 5:72509644-72509666 AGAGTCCCCTGGCTGGCTGCGGG - Intergenic
995738192 5:115325914-115325936 AGAGCCCACTGGCAGCTTTCAGG + Intergenic
995747431 5:115418400-115418422 AAAGTTCAGTGGGTGGTTTCAGG - Intergenic
995760451 5:115556345-115556367 AGATTCCACTGGATCATTTGTGG + Intergenic
996812604 5:127534750-127534772 AGAGTCTACAGGAAGGTCTCAGG - Intronic
997230241 5:132237275-132237297 AGAGGCCACAGGAGGGTTTAGGG - Intronic
999309296 5:150541513-150541535 GGAGTCCACTGACTGGGTTCTGG + Intronic
999799014 5:155015938-155015960 TGAGCACACTGGATTGTTTCTGG - Exonic
1000173729 5:158729299-158729321 AGAGTCCACTGGAGGTATTGAGG - Intronic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1001427995 5:171637011-171637033 AGAGTCCACTGTGTGGCTTTGGG + Intergenic
1007380208 6:41485276-41485298 AGACTGCACTGGTTGGTTGCAGG + Intergenic
1008478250 6:51956940-51956962 AGATTCCACTGGAGGTTTTGAGG + Intronic
1013154118 6:107476779-107476801 AGAGTCCACTGCCTGGTGTCAGG + Intergenic
1013811031 6:114044735-114044757 TGAGTCCACTGGACTGTGTCTGG + Intergenic
1015757171 6:136619374-136619396 AGAATCCACTGAAGGGTTTTAGG + Intronic
1024596053 7:50938739-50938761 AGAGGTGACTGGAAGGTTTCAGG + Intergenic
1025784950 7:64635730-64635752 ACAGTCCACAGGATGGATTGAGG + Intergenic
1027133636 7:75609264-75609286 AGAGCCCACTCTATGGTTTGGGG + Intronic
1031881673 7:127205620-127205642 AGAGGCCACTGGAAGGGTCCAGG + Intronic
1031914360 7:127548956-127548978 AGAGTCAGCTGGAAGGTTCCTGG - Intergenic
1032340474 7:131067650-131067672 AGAGGGCACTGGAAGGTTACAGG + Intergenic
1035051145 7:155999612-155999634 GGAGGACACTGGATGGTTCCGGG + Intergenic
1037307122 8:17516724-17516746 AGAGTCAACTGGATGGGGTGAGG - Intronic
1037831239 8:22190875-22190897 AGCGGACACTCGATGGTTTCAGG - Intronic
1037885101 8:22591724-22591746 ACAGGGCACTGGATGCTTTCAGG + Intronic
1038315730 8:26482880-26482902 AGAATCCACTGGAAGGATTCAGG - Intronic
1039999240 8:42562528-42562550 ATTTTCCACTGGCTGGTTTCGGG + Intergenic
1043417367 8:80064772-80064794 AGAGTCTACTTGGTAGTTTCCGG - Intronic
1043569959 8:81591658-81591680 AGAACCCAGTGGAAGGTTTCAGG - Intergenic
1047453483 8:124988202-124988224 AGTGACCACAGGATGGTTTGGGG - Intergenic
1051037000 9:12759911-12759933 AGAGTCCATGCCATGGTTTCTGG + Intergenic
1051080233 9:13285670-13285692 AGATTGCAATGGATGGTCTCTGG - Intergenic
1051557568 9:18402123-18402145 TGAGCCTTCTGGATGGTTTCAGG - Intergenic
1051756082 9:20402370-20402392 AGAGTTCACTGGAAAGTTGCAGG + Intronic
1052565558 9:30145513-30145535 AGGGGCCACGGGATGGTTTTGGG - Intergenic
1058378432 9:104352326-104352348 AGAGTCCACTGCATGTGTTTAGG - Intergenic
1058905118 9:109476627-109476649 AGAGTCCACTGGAGGTTTGAAGG + Intronic
1187998841 X:24959118-24959140 AGAGTCTATAGGATTGTTTCTGG - Intronic
1189271901 X:39757929-39757951 AGAGTCCACTGGATGAATGCGGG + Intergenic
1191229257 X:58081183-58081205 AGAGTACACTGGCTGATCTCAGG + Intergenic
1191627523 X:63284314-63284336 AGAGTCCACAGCATGGTTATAGG - Intergenic
1192155508 X:68743534-68743556 AGAGGCCACTGGGATGTTTCAGG - Intergenic
1194480499 X:94415794-94415816 AATGACCACTGGATGATTTCAGG + Intergenic
1196048622 X:111281951-111281973 AGGCTCCTCTGGAGGGTTTCTGG + Intergenic
1198656106 X:138914826-138914848 AAAATCCACTGGGTTGTTTCAGG + Intronic