ID: 1075088489

View in Genome Browser
Species Human (GRCh38)
Location 10:119429828-119429850
Sequence GGGTCTTCTGGGCCAGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075088473_1075088489 26 Left 1075088473 10:119429779-119429801 CCCCAGGACACGATTTGAAGACC No data
Right 1075088489 10:119429828-119429850 GGGTCTTCTGGGCCAGCAGCAGG No data
1075088474_1075088489 25 Left 1075088474 10:119429780-119429802 CCCAGGACACGATTTGAAGACCA 0: 1
1: 0
2: 0
3: 32
4: 1044
Right 1075088489 10:119429828-119429850 GGGTCTTCTGGGCCAGCAGCAGG No data
1075088476_1075088489 5 Left 1075088476 10:119429800-119429822 CCAGCAGCCTCTGCCCCCTCCTG 0: 1
1: 1
2: 19
3: 161
4: 1230
Right 1075088489 10:119429828-119429850 GGGTCTTCTGGGCCAGCAGCAGG No data
1075088475_1075088489 24 Left 1075088475 10:119429781-119429803 CCAGGACACGATTTGAAGACCAG 0: 1
1: 0
2: 1
3: 17
4: 320
Right 1075088489 10:119429828-119429850 GGGTCTTCTGGGCCAGCAGCAGG No data
1075088481_1075088489 -8 Left 1075088481 10:119429813-119429835 CCCCCTCCTGAGGCCGGGTCTTC 0: 1
1: 0
2: 0
3: 22
4: 204
Right 1075088489 10:119429828-119429850 GGGTCTTCTGGGCCAGCAGCAGG No data
1075088482_1075088489 -9 Left 1075088482 10:119429814-119429836 CCCCTCCTGAGGCCGGGTCTTCT 0: 1
1: 0
2: 4
3: 21
4: 168
Right 1075088489 10:119429828-119429850 GGGTCTTCTGGGCCAGCAGCAGG No data
1075088478_1075088489 -2 Left 1075088478 10:119429807-119429829 CCTCTGCCCCCTCCTGAGGCCGG 0: 1
1: 0
2: 2
3: 52
4: 457
Right 1075088489 10:119429828-119429850 GGGTCTTCTGGGCCAGCAGCAGG No data
1075088483_1075088489 -10 Left 1075088483 10:119429815-119429837 CCCTCCTGAGGCCGGGTCTTCTG 0: 1
1: 0
2: 3
3: 13
4: 208
Right 1075088489 10:119429828-119429850 GGGTCTTCTGGGCCAGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075088489 Original CRISPR GGGTCTTCTGGGCCAGCAGC AGG Intronic
No off target data available for this crispr