ID: 1075088502

View in Genome Browser
Species Human (GRCh38)
Location 10:119429901-119429923
Sequence TGCATCTCAGTCTGCCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075088502_1075088508 19 Left 1075088502 10:119429901-119429923 CCTGCTGGGCAGACTGAGATGCA No data
Right 1075088508 10:119429943-119429965 GACCTCCTTCGCGTCCTTTGTGG No data
1075088502_1075088507 -8 Left 1075088502 10:119429901-119429923 CCTGCTGGGCAGACTGAGATGCA No data
Right 1075088507 10:119429916-119429938 GAGATGCACAGGTGTAGGGAGGG No data
1075088502_1075088509 20 Left 1075088502 10:119429901-119429923 CCTGCTGGGCAGACTGAGATGCA No data
Right 1075088509 10:119429944-119429966 ACCTCCTTCGCGTCCTTTGTGGG No data
1075088502_1075088512 27 Left 1075088502 10:119429901-119429923 CCTGCTGGGCAGACTGAGATGCA No data
Right 1075088512 10:119429951-119429973 TCGCGTCCTTTGTGGGACGCTGG No data
1075088502_1075088506 -9 Left 1075088502 10:119429901-119429923 CCTGCTGGGCAGACTGAGATGCA No data
Right 1075088506 10:119429915-119429937 TGAGATGCACAGGTGTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075088502 Original CRISPR TGCATCTCAGTCTGCCCAGC AGG (reversed) Intronic