ID: 1075088506

View in Genome Browser
Species Human (GRCh38)
Location 10:119429915-119429937
Sequence TGAGATGCACAGGTGTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075088499_1075088506 13 Left 1075088499 10:119429879-119429901 CCAGGACAGGAAGCACTGTCATC No data
Right 1075088506 10:119429915-119429937 TGAGATGCACAGGTGTAGGGAGG No data
1075088502_1075088506 -9 Left 1075088502 10:119429901-119429923 CCTGCTGGGCAGACTGAGATGCA No data
Right 1075088506 10:119429915-119429937 TGAGATGCACAGGTGTAGGGAGG No data
1075088497_1075088506 19 Left 1075088497 10:119429873-119429895 CCATGCCCAGGACAGGAAGCACT No data
Right 1075088506 10:119429915-119429937 TGAGATGCACAGGTGTAGGGAGG No data
1075088498_1075088506 14 Left 1075088498 10:119429878-119429900 CCCAGGACAGGAAGCACTGTCAT No data
Right 1075088506 10:119429915-119429937 TGAGATGCACAGGTGTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075088506 Original CRISPR TGAGATGCACAGGTGTAGGG AGG Intronic